ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl56f10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC102655.7| Mus musculus chromosome 19, clone RP23-13N2, comp... 44 0.27
2gb|AC163094.5| Mus musculus chromosome 5, clone RP23-123P10, com... 42 1.1
3emb|CR352209.10| Zebrafish DNA sequence from clone DKEY-150O13 i... 42 1.1
4emb|BX663612.9| Zebrafish DNA sequence from clone DKEY-24M14 in ... 42 1.1
5dbj|AK053276.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 42 1.1
6ref|NM_105369.1| Arabidopsis thaliana glycerophosphodiester phos... 40 4.2
7gb|AC164628.8| Mus musculus 6 BAC RP23-82H18 (Roswell Park Cance... 40 4.2
8gb|AC121317.7| Mus musculus chromosome 6, clone RP24-343J20, com... 40 4.2
9gb|AC007152.9| Arabidopsis thaliana chromosome I BAC F1O19 genom... 40 4.2
10ref|XM_731938.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 4.2
11ref|XM_732666.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 4.2
12emb|BX294171.10| Zebrafish DNA sequence from clone DKEY-263M10 i... 40 4.2
13emb|AL953916.14| Zebrafish DNA sequence from clone CH211-246I7 i... 40 4.2
14emb|AL672058.5| Zebrafish DNA sequence from clone BUSM1-47J20 in... 40 4.2
15emb|BX005407.5| Zebrafish DNA sequence from clone CH211-222C22 i... 40 4.2
16gb|AY449460.1| Oikopleura dioica clone BACOIKO004 7xk22, complet... 40 4.2
17emb|AL844859.5| Mouse DNA sequence from clone RP23-263O20 on chr... 40 4.2
18emb|AL604043.11| Mouse DNA sequence from clone RP23-391H8 on chr... 40 4.2

>gb|AC102655.7| Mus musculus chromosome 19, clone RP23-13N2, complete sequence
          Length = 202294

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 169   aataaaaatgtttttggatgaa 190
             ||||||||||||||||||||||
Sbjct: 56757 aataaaaatgtttttggatgaa 56736



to top

>gb|AC163094.5| Mus musculus chromosome 5, clone RP23-123P10, complete sequence
          Length = 208850

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 20    tacacacttgatacatataca 40
             |||||||||||||||||||||
Sbjct: 48749 tacacacttgatacatataca 48729



to top

>emb|CR352209.10| Zebrafish DNA sequence from clone DKEY-150O13 in linkage group 24,
              complete sequence
          Length = 143425

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 22     cacacttgatacatatacaaa 42
              |||||||||||||||||||||
Sbjct: 114349 cacacttgatacatatacaaa 114369



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 22     cacacttgatacatatacaaa 42
              |||||||||||||||||||||
Sbjct: 104510 cacacttgatacatatacaaa 104530



to top

>emb|BX663612.9| Zebrafish DNA sequence from clone DKEY-24M14 in linkage group 7, complete
              sequence
          Length = 181415

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 22     cacacttgatacatatacaaa 42
              |||||||||||||||||||||
Sbjct: 154850 cacacttgatacatatacaaa 154830



to top

>dbj|AK053276.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130006D24 product:unclassifiable, full
            insert sequence
          Length = 3651

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 20   tacacacttgatacatataca 40
            |||||||||||||||||||||
Sbjct: 2970 tacacacttgatacatataca 2990



to top

>ref|NM_105369.1| Arabidopsis thaliana glycerophosphodiester phosphodiesterase/ kinase
            AT1G66980 mRNA, complete cds
          Length = 3512

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 171  taaaaatgtttttggatgaa 190
            ||||||||||||||||||||
Sbjct: 3459 taaaaatgtttttggatgaa 3440



to top

>gb|AC164628.8| Mus musculus 6 BAC RP23-82H18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 205032

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     acacacttgatacatataca 40
              ||||||||||||||||||||
Sbjct: 184660 acacacttgatacatataca 184679



to top

>gb|AC121317.7| Mus musculus chromosome 6, clone RP24-343J20, complete sequence
          Length = 179807

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    acacacttgatacatataca 40
             ||||||||||||||||||||
Sbjct: 23843 acacacttgatacatataca 23862



to top

>gb|AC007152.9| Arabidopsis thaliana chromosome I BAC F1O19 genomic sequence, complete
             sequence
          Length = 90387

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 171   taaaaatgtttttggatgaa 190
             ||||||||||||||||||||
Sbjct: 27065 taaaaatgtttttggatgaa 27084



to top

>ref|XM_731938.1| Plasmodium chabaudi chabaudi hypothetical protein (PC101680.00.0)
           partial mRNA
          Length = 287

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 32  acatatacaaataagcttaa 51
           ||||||||||||||||||||
Sbjct: 213 acatatacaaataagcttaa 232



to top

>ref|XM_732666.1| Plasmodium chabaudi chabaudi hypothetical protein (PC105151.00.0)
           partial mRNA
          Length = 984

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 24  cacttgatacatatacaaat 43
           ||||||||||||||||||||
Sbjct: 599 cacttgatacatatacaaat 618



to top

>emb|BX294171.10| Zebrafish DNA sequence from clone DKEY-263M10 in linkage group 1,
             complete sequence
          Length = 121187

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   ctccaaaaacttgcatcaga 296
             ||||||||||||||||||||
Sbjct: 30564 ctccaaaaacttgcatcaga 30545



to top

>emb|AL953916.14| Zebrafish DNA sequence from clone CH211-246I7 in linkage group 12,
              complete sequence
          Length = 177468

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 171    taaaaatgtttttggatgaa 190
              ||||||||||||||||||||
Sbjct: 161862 taaaaatgtttttggatgaa 161843



to top

>emb|AL672058.5| Zebrafish DNA sequence from clone BUSM1-47J20 in linkage group 1,
              complete sequence
          Length = 130339

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 277    ctccaaaaacttgcatcaga 296
              ||||||||||||||||||||
Sbjct: 100541 ctccaaaaacttgcatcaga 100560



to top

>emb|BX005407.5| Zebrafish DNA sequence from clone CH211-222C22 in linkage group 5,
             complete sequence
          Length = 209796

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    tacacacttgatacatatac 39
             ||||||||||||||||||||
Sbjct: 49955 tacacacttgatacatatac 49936



to top

>gb|AY449460.1| Oikopleura dioica clone BACOIKO004 7xk22, complete sequence
          Length = 131867

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   tttttggatgaaccaccagc 198
             ||||||||||||||||||||
Sbjct: 64488 tttttggatgaaccaccagc 64507



to top

>emb|AL844859.5| Mouse DNA sequence from clone RP23-263O20 on chromosome 2, complete
             sequence
          Length = 151493

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 169   aataaaaatgtttttggatg 188
             ||||||||||||||||||||
Sbjct: 61609 aataaaaatgtttttggatg 61590



to top

>emb|AL604043.11| Mouse DNA sequence from clone RP23-391H8 on chromosome 11, complete
             sequence
          Length = 221374

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    acacacttgatacatataca 40
             ||||||||||||||||||||
Sbjct: 64556 acacacttgatacatataca 64575


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,113,967
Number of Sequences: 3902068
Number of extensions: 3113967
Number of successful extensions: 57307
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57255
Number of HSP's gapped (non-prelim): 52
length of query: 320
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 298
effective length of database: 17,147,199,772
effective search space: 5109865532056
effective search space used: 5109865532056
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top