ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl56f02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_866534.1| PREDICTED: Bos taurus hypothetical LOC528207, t... 44 0.29
2ref|XM_606619.2| PREDICTED: Bos taurus hypothetical LOC528207, t... 44 0.29
3ref|XM_878569.1| PREDICTED: Bos taurus hypothetical LOC528207, t... 44 0.29
4ref|XM_794244.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.5
5gb|AE008732.1| Salmonella typhimurium LT2, section 40 of 220 of ... 40 4.5
6gb|AF286884.4| Homo sapiens chromosome 8 clone RP11-597D18 map 8... 40 4.5
7emb|CR749549.1| Homo sapiens mRNA; cDNA DKFZp686B0392 (from clon... 40 4.5
8gb|AC091699.6| Homo sapiens chromosome 10 clone RP11-296D9, comp... 40 4.5
9gb|AC022026.7| Homo sapiens chromosome 10 clone RP11-506B4, comp... 40 4.5
10gb|AC087855.6| Homo sapiens chromosome 8, clone RP11-431M3, comp... 40 4.5
11gb|AC087671.9| Homo sapiens chromosome 8, clone RP11-597D18, com... 40 4.5
12dbj|AK143483.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN ... 40 4.5
13gb|AC092756.2| Homo sapiens chromosome 15 clone RP11-429D19 map ... 40 4.5
14gb|AC092868.2| Homo sapiens chromosome 15 clone RP11-356M20 map ... 40 4.5
15gb|AC126308.6| Homo sapiens 12 BAC RP11-586L15 (Roswell Park Can... 40 4.5
16emb|AL929106.5| Mouse DNA sequence from clone RP23-446N16 on chr... 40 4.5
17emb|AL663032.9| Mouse DNA sequence from clone RP23-27I6 on chrom... 40 4.5

>ref|XM_866534.1| PREDICTED: Bos taurus hypothetical LOC528207, transcript variant 2
           (LOC528207), mRNA
          Length = 2283

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 262 ctacatttcctagtagtaacta 283
           ||||||||||||||||||||||
Sbjct: 611 ctacatttcctagtagtaacta 632



to top

>ref|XM_606619.2| PREDICTED: Bos taurus hypothetical LOC528207, transcript variant 1
           (LOC528207), mRNA
          Length = 2250

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 262 ctacatttcctagtagtaacta 283
           ||||||||||||||||||||||
Sbjct: 611 ctacatttcctagtagtaacta 632



to top

>ref|XM_878569.1| PREDICTED: Bos taurus hypothetical LOC528207, transcript variant 3
           (LOC528207), mRNA
          Length = 2280

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 262 ctacatttcctagtagtaacta 283
           ||||||||||||||||||||||
Sbjct: 611 ctacatttcctagtagtaacta 632



to top

>ref|XM_794244.1| PREDICTED: Strongylocentrotus purpuratus similar to Zinc finger
            homeobox protein 1b (Smad interacting protein 1)
            (LOC594820), mRNA
          Length = 4092

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 225  gatctttctctgccaaagag 244
            ||||||||||||||||||||
Sbjct: 2968 gatctttctctgccaaagag 2987



to top

>gb|AE008732.1| Salmonella typhimurium LT2, section 40 of 220 of the complete genome
          Length = 22407

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gccctggatctttctctgcc 238
             ||||||||||||||||||||
Sbjct: 20869 gccctggatctttctctgcc 20888



to top

>gb|AF286884.4| Homo sapiens chromosome 8 clone RP11-597D18 map 8p21-p11, complete
              sequence
          Length = 207519

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    tacatacacaaatatttaca 170
              ||||||||||||||||||||
Sbjct: 176081 tacatacacaaatatttaca 176062



to top

>emb|CR749549.1| Homo sapiens mRNA; cDNA DKFZp686B0392 (from clone DKFZp686B0392)
          Length = 4650

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 151  tacatacacaaatatttaca 170
            ||||||||||||||||||||
Sbjct: 4436 tacatacacaaatatttaca 4455



to top

>gb|AC091699.6| Homo sapiens chromosome 10 clone RP11-296D9, complete sequence
          Length = 196856

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 155    tacacaaatatttacatcag 174
              ||||||||||||||||||||
Sbjct: 158595 tacacaaatatttacatcag 158614



to top

>gb|AC022026.7| Homo sapiens chromosome 10 clone RP11-506B4, complete sequence
          Length = 170834

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 155   tacacaaatatttacatcag 174
             ||||||||||||||||||||
Sbjct: 42759 tacacaaatatttacatcag 42778



to top

>gb|AC087855.6| Homo sapiens chromosome 8, clone RP11-431M3, complete sequence
          Length = 161256

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    tacatacacaaatatttaca 170
              ||||||||||||||||||||
Sbjct: 121491 tacatacacaaatatttaca 121472



to top

>gb|AC087671.9| Homo sapiens chromosome 8, clone RP11-597D18, complete sequence
          Length = 207503

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   tacatacacaaatatttaca 170
             ||||||||||||||||||||
Sbjct: 31440 tacatacacaaatatttaca 31459



to top

>dbj|AK143483.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN full-length enriched
            library, clone:E860012J18 product:unclassifiable, full
            insert sequence
          Length = 4247

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 147  tacctacatacacaaatatt 166
            ||||||||||||||||||||
Sbjct: 1608 tacctacatacacaaatatt 1589



to top

>gb|AC092756.2| Homo sapiens chromosome 15 clone RP11-429D19 map 15q21.3, complete
              sequence
          Length = 189999

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 61     tactactaccactgtcactc 80
              ||||||||||||||||||||
Sbjct: 188017 tactactaccactgtcactc 188036



to top

>gb|AC092868.2| Homo sapiens chromosome 15 clone RP11-356M20 map 15q21.3, complete
             sequence
          Length = 157533

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    tactactaccactgtcactc 80
             ||||||||||||||||||||
Sbjct: 22748 tactactaccactgtcactc 22767



to top

>gb|AC126308.6| Homo sapiens 12 BAC RP11-586L15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 85752

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 152   acatacacaaatatttacat 171
             ||||||||||||||||||||
Sbjct: 74837 acatacacaaatatttacat 74818



to top

>emb|AL929106.5| Mouse DNA sequence from clone RP23-446N16 on chromosome 2, complete
             sequence
          Length = 130872

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 147   tacctacatacacaaatatt 166
             ||||||||||||||||||||
Sbjct: 95435 tacctacatacacaaatatt 95416



to top

>emb|AL663032.9| Mouse DNA sequence from clone RP23-27I6 on chromosome X, complete
              sequence
          Length = 162995

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 151    tacatacacaaatatttacatcag 174
              |||||||| |||||||||||||||
Sbjct: 160137 tacatacataaatatttacatcag 160160


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,896,797
Number of Sequences: 3902068
Number of extensions: 2896797
Number of successful extensions: 57238
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57213
Number of HSP's gapped (non-prelim): 25
length of query: 339
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 317
effective length of database: 17,147,199,772
effective search space: 5435662327724
effective search space used: 5435662327724
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top