>gb|AC114786.4| Homo sapiens BAC clone RP11-618I10 from 4, complete sequence
          Length = 148977

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 157  aataaagttaaaatcagttaag 178
            ||||||||||||||||||||||
Sbjct: 4813 aataaagttaaaatcagttaag 4792

>ref|XM_980774.1| PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor
            type 3 (Ptpn3), mRNA
          Length = 6723

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 356  aactaggctctgcataaggct 376
            |||||||||||||||||||||
Sbjct: 3959 aactaggctctgcataaggct 3979

>ref|XM_485383.4| PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor
            type 3, transcript variant 1 (Ptpn3), mRNA
          Length = 6723

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 356  aactaggctctgcataaggct 376
            |||||||||||||||||||||
Sbjct: 3959 aactaggctctgcataaggct 3979

>ref|XM_921203.2| PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor
            type 3, transcript variant 6 (Ptpn3), mRNA
          Length = 6284

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 356  aactaggctctgcataaggct 376
            |||||||||||||||||||||
Sbjct: 3520 aactaggctctgcataaggct 3540

>dbj|AK035295.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
            enriched library, clone:9530011I20
            product:unclassifiable, full insert sequence
          Length = 2414

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 356  aactaggctctgcataaggct 376
            |||||||||||||||||||||
Sbjct: 1781 aactaggctctgcataaggct 1801

>emb|AL805921.7| Mouse DNA sequence from clone RP23-293N9 on chromosome 4, complete
             sequence
          Length = 162090

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 356   aactaggctctgcataaggct 376
             |||||||||||||||||||||
Sbjct: 53805 aactaggctctgcataaggct 53785

>emb|AL713854.9| Mouse DNA sequence from clone RP23-477E1 on chromosome 8, complete
             sequence
          Length = 169876

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 59    ccaaaccaacatctgaccttctgaa 83
             |||||||||| ||||||||||||||
Sbjct: 73408 ccaaaccaacttctgaccttctgaa 73432

>gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, complete sequence
          Length = 168316

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 162   agttaaaatcagttaagctgaaac 185
             ||||||||||| ||||||||||||
Sbjct: 56968 agttaaaatcaattaagctgaaac 56945

>emb|AL049595.5|HSJ501M23 Human DNA sequence from clone RP3-501M23 on chromosome 6q13-14.3,
             complete sequence
          Length = 76782

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 253   cacttgagatggcactcgta 272
             ||||||||||||||||||||
Sbjct: 70808 cacttgagatggcactcgta 70789

>gb|AC158295.5| Mus musculus chromosome 8, clone RP24-208G23, complete sequence
          Length = 167209

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 162   agttaaaatcagttaagctgaaac 185
             ||||||||||| ||||||||||||
Sbjct: 84366 agttaaaatcaattaagctgaaac 84389

>gb|U23521.1| Caenorhabditis elegans cosmid F41C3, complete sequence
          Length = 38897

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    gcaagattacttcaattcaa 38
             ||||||||||||||||||||
Sbjct: 34868 gcaagattacttcaattcaa 34849

>emb|AL133279.7|CNS01DUM Human chromosome 14 DNA sequence BAC R-753D20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 197224

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   ttaccaaaagatcacagcac 305
             ||||||||||||||||||||
Sbjct: 85382 ttaccaaaagatcacagcac 85363

>gb|AC125066.5| Mus musculus BAC clone RP23-430N17 from 16, complete sequence
          Length = 197813

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   tgagaataaagttaaaatca 172
             ||||||||||||||||||||
Sbjct: 15682 tgagaataaagttaaaatca 15701


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,374,573
Number of Sequences: 3902068
Number of extensions: 3374573
Number of successful extensions: 49678
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49660
Number of HSP's gapped (non-prelim): 18
length of query: 385
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 363
effective length of database: 17,147,199,772
effective search space: 6224433517236
effective search space used: 6224433517236
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)