ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl56e07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|CP000025.1| Campylobacter jejuni RM1221, complete genome 40 2.6
2gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome 40 2.6
3emb|AL160010.14| Human DNA sequence from clone RP11-146P20 on ch... 40 2.6
4emb|AL139076.2|CJ11168X3 Campylobacter jejuni subsp. jejuni NCTC... 40 2.6
5emb|BX901956.4| Zebrafish DNA sequence from clone CH211-284C12 i... 40 2.6
6gb|AC097061.2| Homo sapiens chromosome 1 clone RP11-415L24, comp... 40 2.6
7gb|AC018793.12| Homo sapiens chromosome 11, clone RP11-437G21, c... 40 2.6
8gb|AY232508.1| Donacia japana isolate N264 cytochrome oxidase su... 40 2.6
9gb|AY232507.1| Donacia japana isolate N119 cytochrome oxidase su... 40 2.6
10gb|AY232506.1| Donacia japana isolate N79 cytochrome oxidase sub... 40 2.6
11gb|AC010894.10| Homo sapiens BAC clone RP11-483E17 from 2, compl... 40 2.6
12dbj|AB005236.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 2.6
13emb|AL935200.9| Zebrafish DNA sequence from clone CH211-237I5, c... 40 2.6 
>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     tttaagctctataaatttaa 110
              ||||||||||||||||||||
Sbjct: 798940 tttaagctctataaatttaa 798959
to top
>gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome
          Length = 1485148

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 87      actttttaagctctataaat 106
               ||||||||||||||||||||
Sbjct: 1103611 actttttaagctctataaat 1103630
to top
>emb|AL160010.14| Human DNA sequence from clone RP11-146P20 on chromosome 10 Contains
             part of the gene for VPS10 domain receptor protein SORCS
             1, complete sequence
          Length = 158724

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   catgcagacggaagcagagg 167
             ||||||||||||||||||||
Sbjct: 93875 catgcagacggaagcagagg 93894
to top
>emb|AL139076.2|CJ11168X3 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment
             3/6
          Length = 317511

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 91    tttaagctctataaatttaa 110
             ||||||||||||||||||||
Sbjct: 97835 tttaagctctataaatttaa 97854
to top
>emb|BX901956.4| Zebrafish DNA sequence from clone CH211-284C12 in linkage group 3,
              complete sequence
          Length = 197042

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tcagagttcacaaatggtgt 31
              ||||||||||||||||||||
Sbjct: 168687 tcagagttcacaaatggtgt 168668
to top
>gb|AC097061.2| Homo sapiens chromosome 1 clone RP11-415L24, complete sequence
          Length = 165311

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 149   atgcagacggaagcagaggc 168
             ||||||||||||||||||||
Sbjct: 90987 atgcagacggaagcagaggc 90968
to top
>gb|AC018793.12| Homo sapiens chromosome 11, clone RP11-437G21, complete sequence
          Length = 202956

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   aagcagaggcaaatgcagct 178
             ||||||||||||||||||||
Sbjct: 99826 aagcagaggcaaatgcagct 99807
to top
>gb|AY232508.1| Donacia japana isolate N264 cytochrome oxidase subunit I gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 750

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ttttaagctctataaattta 109
           ||||||||||||||||||||
Sbjct: 645 ttttaagctctataaattta 664
to top
>gb|AY232507.1| Donacia japana isolate N119 cytochrome oxidase subunit I gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 750

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ttttaagctctataaattta 109
           ||||||||||||||||||||
Sbjct: 645 ttttaagctctataaattta 664
to top
>gb|AY232506.1| Donacia japana isolate N79 cytochrome oxidase subunit I gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 750

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ttttaagctctataaattta 109
           ||||||||||||||||||||
Sbjct: 645 ttttaagctctataaattta 664
to top
>gb|AC010894.10| Homo sapiens BAC clone RP11-483E17 from 2, complete sequence
          Length = 181663

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 95     agctctataaatttaaatta 114
              ||||||||||||||||||||
Sbjct: 175855 agctctataaatttaaatta 175836
to top
>dbj|AB005236.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK22
          Length = 82035

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    tactttttaagctctataaa 105
             ||||||||||||||||||||
Sbjct: 24387 tactttttaagctctataaa 24368
to top
>emb|AL935200.9| Zebrafish DNA sequence from clone CH211-237I5, complete sequence
          Length = 160710

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcagagttcacaaatggtgt 31
             ||||||||||||||||||||
Sbjct: 56194 tcagagttcacaaatggtgt 56213


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,604,192
Number of Sequences: 3902068
Number of extensions: 1604192
Number of successful extensions: 127827
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 127744
Number of HSP's gapped (non-prelim): 83
length of query: 208
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 186
effective length of database: 17,147,199,772
effective search space: 3189379157592
effective search space used: 3189379157592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top