Clone Name	rbastl56d08
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AC149607.6| Mus musculus BAC clone RP23-455C13 from chromosom...	48	0.017
2	gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, com...	44	0.27
3	gb|AC165966.3| Mus musculus BAC clone RP23-259L2 from chromosome...	44	0.27
4	gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, com...	44	0.27
5	ref|XM_951656.1| Neurospora crassa OR74A hypothetical protein (N...	42	1.1
6	ref|XM_327910.1| Neurospora crassa OR74A hypothetical protein (N...	42	1.1
7	gb|AC146218.2| Pan troglodytes BAC clone CH251-267E2 from Y, com...	42	1.1
8	emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome	42	1.1
9	emb|BX842620.1| Neurospora crassa DNA linkage group V BAC contig...	42	1.1
10	emb|AL683829.15| Mouse DNA sequence from clone RP23-64F17 on chr...	42	1.1
11	gb|AC153815.7| Mus musculus 6 BAC RP23-205F19 (Roswell Park Canc...	42	1.1
12	dbj|BS000645.2| Pan troglodytes chromosome Y clone: PTB-520M19, ...	42	1.1
13	dbj|BS000539.1| Pan troglodytes chromosome Y clone:PTB-144M03, c...	42	1.1
14	dbj|BS000535.1| Pan troglodytes chromosome Y clone:PTB-096E06, c...	42	1.1
15	gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence	42	1.1
16	gb|AC093500.2| Drosophila melanogaster 3L BAC RP98-29P5 (Roswell...	42	1.1
17	gb|AC010716.4| Drosophila melanogaster 3L BAC RP98-11A21 (Roswel...	42	1.1
18	gb|AC105155.9| Mus musculus chromosome 3, clone RP24-346C8, comp...	42	1.1
19	gb|AC012104.6|AC012104 Mus musculus chromosome , clone CT7-478J1...	42	1.1
20	emb|AL359400.4|CNS05TEW Human chromosome 14 DNA sequence BAC R-1...	42	1.1
21	gb|AE003564.3| Drosophila melanogaster chromosome 3L, section 21...	42	1.1
22	gb|AC115871.8| Mus musculus chromosome 5, clone RP24-343A12, com...	40	4.2
23	gb|BC103849.1| Homo sapiens high-mobility group (nonhistone chro...	40	4.2
24	gb|BC103850.1| Homo sapiens high-mobility group (nonhistone chro...	40	4.2
25	gb|BC103851.1| Homo sapiens high-mobility group (nonhistone chro...	40	4.2
26	gb|AC161342.10| Mus musculus chromosome 1, clone RP23-313K17, co...	40	4.2
27	gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence	40	4.2
28	gb|AC161176.5| Mus musculus chromosome 5, clone RP24-295A5, comp...	40	4.2
29	gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome ...	40	4.2
30	gb|AC129013.3| Mus musculus BAC clone RP24-550P17 from chromosom...	40	4.2
31	ref|NR_002165.1| Homo sapiens high-mobility group (nonhistone ch...	40	4.2
32	gb|AC124276.5| Homo sapiens chromosome 11, clone RP13-631K18, co...	40	4.2
33	gb|BC059784.1| Mus musculus cDNA clone IMAGE:4951210, partial cds	40	4.2
34	gb|AC109169.13| Mus musculus chromosome 6, clone RP23-5D6, compl...	40	4.2
35	gb|AC160032.7| Mus musculus 6 BAC RP24-179I4 (Roswell Park Cance...	40	4.2
36	emb|AL049709.18|HSDJ18C9 Human DNA sequence from clone RP1-18C9 ...	40	4.2
37	gb|AC159882.2| Mus musculus BAC clone RP24-480A4 from chromosome...	40	4.2
38	gb|AC161426.5| Mus musculus BAC clone RP23-69L13 from chromosome...	40	4.2
39	gb|AC011907.4| Drosophila melanogaster 3L BAC RP98-18B21 (Roswel...	40	4.2
40	tpg|BK001849.1| TPA: TPA_inf: Drosophila melanogaster HDC07783 (...	40	4.2
41	gb|AC025106.8| Homo sapiens chromosome 11, clone RP11-734D5, com...	40	4.2
42	gb|AC156542.9| Mus musculus chromosome 1, clone RP23-370J16, com...	40	4.2
43	gb|AC091219.2| Drosophila melanogaster 3L BAC RP98-4C3 (Roswell ...	40	4.2
44	gb|AC112679.15| Mus musculus chromosome 1, clone RP23-199H14, co...	40	4.2
45	gb|AC055818.9|AC055818 Mus musculus, clone RP23-129C12, complete...	40	4.2
46	gb|AC097173.1| Homo sapiens BAC clone RP11-96A1 from 4, complete...	40	4.2
47	gb|AC118656.4| Homo sapiens chromosome 11, clone RP11-313H5, com...	40	4.2
48	emb|AJ343967.1|HEC343967 Hepatitis C virus partial mRNA for enve...	40	4.2
49	gb|AC154777.2| Mus musculus BAC clone RP24-459H24 from 14, compl...	40	4.2
50	gb|AC147513.16| Mus musculus chromosome 1, clone RP23-105K16, co...	40	4.2
51	gb|AE003469.3| Drosophila melanogaster chromosome 3L, section 3 ...	40	4.2
52	gb|AC162375.2| Mus musculus BAC clone RP24-466F1 from chromosome...	40	4.2
53	gb|AC125143.4| Mus musculus BAC clone RP24-342H13 from 17, compl...	40	4.2
54	gb|AC132228.3| Mus musculus BAC clone RP24-480G11 from 6, comple...	40	4.2
55	gb|AC168090.3| Mus musculus BAC clone RP24-272N5 from chromosome...	40	4.2
56	emb|AL772235.4| Mouse DNA sequence from clone RP23-155K12 on chr...	40	4.2
57	emb|AL606919.12| Mouse DNA sequence from clone RP23-264F10 on ch...	40	4.2

---

>gb|AC149607.6| Mus musculus BAC clone RP23-455C13 from chromosome 7, complete sequence
          Length = 206284

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 112   aagaatggggaggaagagaaggagaata 139
             ||||| ||||||||||||||||||||||
Sbjct: 74107 aagaagggggaggaagagaaggagaata 74134

---

>gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, complete sequence
          Length = 43869

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 112   aagaatggggaggaagagaaggagaa 137
             ||||| ||||||||||||||||||||
Sbjct: 29736 aagaagggggaggaagagaaggagaa 29761

---

>gb|AC165966.3| Mus musculus BAC clone RP23-259L2 from chromosome 17, complete sequence
          Length = 194944

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 114   gaatggggaggaagagaaggag 135
             ||||||||||||||||||||||
Sbjct: 68991 gaatggggaggaagagaaggag 68970

---

>gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, complete sequence
          Length = 199824

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 112   aagaatggggaggaagagaaggagaa 137
             ||||| ||||||||||||||||||||
Sbjct: 39396 aagaagggggaggaagagaaggagaa 39421

---

>ref|XM_951656.1| Neurospora crassa OR74A hypothetical protein (NCU01472.1) partial
            mRNA
          Length = 4494

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 109  gataagaatggggaggaagag 129
            |||||||||||||||||||||
Sbjct: 4366 gataagaatggggaggaagag 4386

---

>ref|XM_327910.1| Neurospora crassa OR74A hypothetical protein (NCU01472.1) partial
            mRNA
          Length = 4494

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 109  gataagaatggggaggaagag 129
            |||||||||||||||||||||
Sbjct: 4366 gataagaatggggaggaagag 4386

---

>gb|AC146218.2| Pan troglodytes BAC clone CH251-267E2 from Y, complete sequence
          Length = 203014

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 115    aatggggaggaagagaaggag 135
              |||||||||||||||||||||
Sbjct: 145558 aatggggaggaagagaaggag 145578

---

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 73      gtcacagagagatccattaca 93
               |||||||||||||||||||||
Sbjct: 2613128 gtcacagagagatccattaca 2613148

---

>emb|BX842620.1| Neurospora crassa DNA linkage group V BAC contig B11E5
          Length = 191196

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 109   gataagaatggggaggaagag 129
             |||||||||||||||||||||
Sbjct: 42154 gataagaatggggaggaagag 42174

---

>emb|AL683829.15| Mouse DNA sequence from clone RP23-64F17 on chromosome 4 Contains two
              novel genes, the gene for a novel major urinary protein
              (Mup) family member, the Zfp37 gene for zinc finger protein
              37, the Slc31a2 gene for solute carrier family 31 member 2
              and two CpG islands, complete sequence
          Length = 223133

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 113    agaatggggaggaagagaaggagaa 137
              |||| ||||||||||||||||||||
Sbjct: 145640 agaagggggaggaagagaaggagaa 145616



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 113    agaatggggaggaagagaaggagaa 137
              |||| ||||||||||||||||||||
Sbjct: 137615 agaagggggaggaagagaaggagaa 137639

---

>gb|AC153815.7| Mus musculus 6 BAC RP23-205F19 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 230983

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 107    gagataagaatggggaggaagagaa 131
              |||||||| ||||||||||||||||
Sbjct: 152766 gagataaggatggggaggaagagaa 152790

---

>dbj|BS000645.2| Pan troglodytes chromosome Y clone: PTB-520M19, complete sequence
          Length = 166301

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 115   aatggggaggaagagaaggag 135
             |||||||||||||||||||||
Sbjct: 11245 aatggggaggaagagaaggag 11225

---

>dbj|BS000539.1| Pan troglodytes chromosome Y clone:PTB-144M03, complete sequences
          Length = 21701

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 115   aatggggaggaagagaaggag 135
             |||||||||||||||||||||
Sbjct: 21399 aatggggaggaagagaaggag 21419

---

>dbj|BS000535.1| Pan troglodytes chromosome Y clone:PTB-096E06, complete sequences
          Length = 198405

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 115    aatggggaggaagagaaggag 135
              |||||||||||||||||||||
Sbjct: 134875 aatggggaggaagagaaggag 134895

---

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 115      aatggggaggaagagaaggag 135
                |||||||||||||||||||||
Sbjct: 19421147 aatggggaggaagagaaggag 19421167

---

>gb|AC093500.2| Drosophila melanogaster 3L BAC RP98-29P5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 173558

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    actactccgaccgaccgaccg 262
              |||||||||||||||||||||
Sbjct: 154645 actactccgaccgaccgaccg 154625

---

>gb|AC010716.4| Drosophila melanogaster 3L BAC RP98-11A21 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 173386

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   actactccgaccgaccgaccg 262
             |||||||||||||||||||||
Sbjct: 59574 actactccgaccgaccgaccg 59554

---

>gb|AC105155.9| Mus musculus chromosome 3, clone RP24-346C8, complete sequence
          Length = 162298

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 113   agaatggggaggaagagaagg 133
             |||||||||||||||||||||
Sbjct: 42415 agaatggggaggaagagaagg 42435

---

>gb|AC012104.6|AC012104 Mus musculus chromosome , clone CT7-478J15, complete sequence
          Length = 124373

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 107   gagataagaatggggaggaagagaa 131
             |||||||| ||||||||||||||||
Sbjct: 41886 gagataaggatggggaggaagagaa 41910

---

>emb|AL359400.4|CNS05TEW Human chromosome 14 DNA sequence BAC R-114L12 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 175668

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 209    tttaggcaaaatgtgggctac 229
              |||||||||||||||||||||
Sbjct: 126580 tttaggcaaaatgtgggctac 126600

---

>gb|AE003564.3| Drosophila melanogaster chromosome 3L, section 21 of 83 of the complete
             sequence
          Length = 315944

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   actactccgaccgaccgaccg 262
             |||||||||||||||||||||
Sbjct: 39674 actactccgaccgaccgaccg 39654

---

>gb|AC115871.8| Mus musculus chromosome 5, clone RP24-343A12, complete sequence
          Length = 175928

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   ggggaggaagagaaggagaa 137
             ||||||||||||||||||||
Sbjct: 60861 ggggaggaagagaaggagaa 60842

---

>gb|BC103849.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           4-like, mRNA (cDNA clone MGC:118987 IMAGE:40002762),
           complete cds
          Length = 888

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 116 atggggaggaagagaaggag 135
           ||||||||||||||||||||
Sbjct: 860 atggggaggaagagaaggag 879

---

>gb|BC103850.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           4-like, mRNA (cDNA clone MGC:118988 IMAGE:40002763),
           complete cds
          Length = 887

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 116 atggggaggaagagaaggag 135
           ||||||||||||||||||||
Sbjct: 859 atggggaggaagagaaggag 878

---

>gb|BC103851.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           4-like, mRNA (cDNA clone MGC:118989 IMAGE:40002765),
           complete cds
          Length = 887

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 116 atggggaggaagagaaggag 135
           ||||||||||||||||||||
Sbjct: 859 atggggaggaagagaaggag 878

---

>gb|AC161342.10| Mus musculus chromosome 1, clone RP23-313K17, complete sequence
          Length = 181572

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tggggaggaagagaaggaga 136
             ||||||||||||||||||||
Sbjct: 84798 tggggaggaagagaaggaga 84779

---

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 256     ccgaccgactacccgaatca 275
               ||||||||||||||||||||
Sbjct: 1578509 ccgaccgactacccgaatca 1578528

---

>gb|AC161176.5| Mus musculus chromosome 5, clone RP24-295A5, complete sequence
          Length = 157001

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   aatggggaggaagagaagga 134
             ||||||||||||||||||||
Sbjct: 89209 aatggggaggaagagaagga 89190

---

>gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome 6, complete sequence
          Length = 264135

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   ggggaggaagagaaggagaa 137
             ||||||||||||||||||||
Sbjct: 80758 ggggaggaagagaaggagaa 80739

---

>gb|AC129013.3| Mus musculus BAC clone RP24-550P17 from chromosome 6, complete sequence
          Length = 169094

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   ggggaggaagagaaggagaa 137
             ||||||||||||||||||||
Sbjct: 92001 ggggaggaagagaaggagaa 92020

---

>ref|NR_002165.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           4-like (HMG4L) on chromosome 20
          Length = 888

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 116 atggggaggaagagaaggag 135
           ||||||||||||||||||||
Sbjct: 860 atggggaggaagagaaggag 879

---

>gb|AC124276.5| Homo sapiens chromosome 11, clone RP13-631K18, complete sequence
          Length = 195122

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   aatggggaggaagagaagga 134
             ||||||||||||||||||||
Sbjct: 14274 aatggggaggaagagaagga 14293

---

>gb|BC059784.1| Mus musculus cDNA clone IMAGE:4951210, partial cds
          Length = 1517

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 118  ggggaggaagagaaggagaa 137
            ||||||||||||||||||||
Sbjct: 1171 ggggaggaagagaaggagaa 1190

---

>gb|AC109169.13| Mus musculus chromosome 6, clone RP23-5D6, complete sequence
          Length = 204911

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 118    ggggaggaagagaaggagaa 137
              ||||||||||||||||||||
Sbjct: 177307 ggggaggaagagaaggagaa 177288

---

>gb|AC160032.7| Mus musculus 6 BAC RP24-179I4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 200439

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   ggggaggaagagaaggagaa 137
             ||||||||||||||||||||
Sbjct: 24028 ggggaggaagagaaggagaa 24009

---

>emb|AL049709.18|HSDJ18C9 Human DNA sequence from clone RP1-18C9 on chromosome 20 Contains the 5'
             end of the ACAS2 gene for acetyl-Coenzyme A synthetase 2
             (ADP forming), the GGTL3 gene for gamma-
             glutamyltranspeptidase-like 3 protein, the HMG4L
             pseudogene similar to high mobility group proteins, the 5'
             end of the AIB3 gene for thyroid hormone receptor binding
             protein (KIAA0181) and four CpG Islands, complete sequence
          Length = 126755

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   atggggaggaagagaaggag 135
             ||||||||||||||||||||
Sbjct: 39706 atggggaggaagagaaggag 39687

---

>gb|AC159882.2| Mus musculus BAC clone RP24-480A4 from chromosome 9, complete sequence
          Length = 178827

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 121    gaggaagagaaggagaatac 140
              ||||||||||||||||||||
Sbjct: 163271 gaggaagagaaggagaatac 163290

---

>gb|AC161426.5| Mus musculus BAC clone RP23-69L13 from chromosome 10, complete sequence
          Length = 255667

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 120    ggaggaagagaaggagaata 139
              ||||||||||||||||||||
Sbjct: 144843 ggaggaagagaaggagaata 144862

---

>gb|AC011907.4| Drosophila melanogaster 3L BAC RP98-18B21 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 164597

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 245    actccgaccgaccgaccgac 264
              ||||||||||||||||||||
Sbjct: 157943 actccgaccgaccgaccgac 157962

---

>tpg|BK001849.1| TPA: TPA_inf: Drosophila melanogaster HDC07783 (HDC07783) gene,
           complete cds
          Length = 3189

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 actccgaccgaccgaccgac 264
           ||||||||||||||||||||
Sbjct: 60  actccgaccgaccgaccgac 79

---

>gb|AC025106.8| Homo sapiens chromosome 11, clone RP11-734D5, complete sequence
          Length = 190779

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   aatggggaggaagagaagga 134
             ||||||||||||||||||||
Sbjct: 63457 aatggggaggaagagaagga 63476

---

>gb|AC156542.9| Mus musculus chromosome 1, clone RP23-370J16, complete sequence
          Length = 168193

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   ggggaggaagagaaggagaa 137
             ||||||||||||||||||||
Sbjct: 91949 ggggaggaagagaaggagaa 91930

---

>gb|AC091219.2| Drosophila melanogaster 3L BAC RP98-4C3 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 168047

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 245   actccgaccgaccgaccgac 264
             ||||||||||||||||||||
Sbjct: 28905 actccgaccgaccgaccgac 28924

---

>gb|AC112679.15| Mus musculus chromosome 1, clone RP23-199H14, complete sequence
          Length = 185805

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   ggggaggaagagaaggagaa 137
             ||||||||||||||||||||
Sbjct: 37612 ggggaggaagagaaggagaa 37593

---

>gb|AC055818.9|AC055818 Mus musculus, clone RP23-129C12, complete sequence
          Length = 237678

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 112    aagaatggggaggaagagaaggag 135
              ||||| ||||||||||||||||||
Sbjct: 170697 aagaagggggaggaagagaaggag 170720

---

>gb|AC097173.1| Homo sapiens BAC clone RP11-96A1 from 4, complete sequence
          Length = 175629

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 113   agaatggggaggaagagaaggaga 136
             ||||||||||||||| ||||||||
Sbjct: 97766 agaatggggaggaagggaaggaga 97743

---

>gb|AC118656.4| Homo sapiens chromosome 11, clone RP11-313H5, complete sequence
          Length = 155143

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 115    aatggggaggaagagaagga 134
              ||||||||||||||||||||
Sbjct: 155033 aatggggaggaagagaagga 155014

---

>emb|AJ343967.1|HEC343967 Hepatitis C virus partial mRNA for envelope protein (E2 gene),
           isolate ETR7
          Length = 387

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 120 ggaggaagagaaggagaata 139
           ||||||||||||||||||||
Sbjct: 322 ggaggaagagaaggagaata 303

---

>gb|AC154777.2| Mus musculus BAC clone RP24-459H24 from 14, complete sequence
          Length = 155730

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 120   ggaggaagagaaggagaata 139
             ||||||||||||||||||||
Sbjct: 26051 ggaggaagagaaggagaata 26032

---

>gb|AC147513.16| Mus musculus chromosome 1, clone RP23-105K16, complete sequence
          Length = 209834

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    tggggaggaagagaaggaga 136
              ||||||||||||||||||||
Sbjct: 124602 tggggaggaagagaaggaga 124583

---

>gb|AE003469.3| Drosophila melanogaster chromosome 3L, section 3 of 83 of the complete
             sequence
          Length = 286515

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 245   actccgaccgaccgaccgac 264
             ||||||||||||||||||||
Sbjct: 15584 actccgaccgaccgaccgac 15603

---

>gb|AC162375.2| Mus musculus BAC clone RP24-466F1 from chromosome 9, complete sequence
          Length = 164119

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 121   gaggaagagaaggagaatac 140
             ||||||||||||||||||||
Sbjct: 11147 gaggaagagaaggagaatac 11166

---

>gb|AC125143.4| Mus musculus BAC clone RP24-342H13 from 17, complete sequence
          Length = 219259

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    atggggaggaagagaaggag 135
              ||||||||||||||||||||
Sbjct: 144608 atggggaggaagagaaggag 144589

---

>gb|AC132228.3| Mus musculus BAC clone RP24-480G11 from 6, complete sequence
          Length = 180203

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   ggggaggaagagaaggagaa 137
             ||||||||||||||||||||
Sbjct: 59657 ggggaggaagagaaggagaa 59638

---

>gb|AC168090.3| Mus musculus BAC clone RP24-272N5 from chromosome 17, complete sequence
          Length = 157940

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   atggggaggaagagaaggag 135
             ||||||||||||||||||||
Sbjct: 29571 atggggaggaagagaaggag 29552

---

>emb|AL772235.4| Mouse DNA sequence from clone RP23-155K12 on chromosome 2, complete
              sequence
          Length = 190410

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    tggggaggaagagaaggaga 136
              ||||||||||||||||||||
Sbjct: 160022 tggggaggaagagaaggaga 160003

---

>emb|AL606919.12| Mouse DNA sequence from clone RP23-264F10 on chromosome 4, complete
             sequence
          Length = 187816

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   atggggaggaagagaaggag 135
             ||||||||||||||||||||
Sbjct: 60268 atggggaggaagagaaggag 60249


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,260,508
Number of Sequences: 3902068
Number of extensions: 3260508
Number of successful extensions: 93656
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93450
Number of HSP's gapped (non-prelim): 206
length of query: 320
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 298
effective length of database: 17,147,199,772
effective search space: 5109865532056
effective search space used: 5109865532056
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---