ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl56b12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL713860.12| Mouse DNA sequence from clone RP23-446K18 on ch... 40 0.64
2emb|AL713885.1|CNS07YP2 Mus musculus chromosome 11 region in the... 40 0.64
3gb|AC091257.13| Mus musculus chromosome 6, clone RP23-154A4, com... 38 2.5
4gb|AC163682.3| Mus musculus BAC clone RP24-124O15 from chromosom... 38 2.5
5gb|AC021810.7|AC021810 Homo sapiens chromosome 18, clone RP11-82... 38 2.5
6gb|AC113407.2| Homo sapiens chromosome 5 clone RP11-475J5, compl... 38 2.5
7emb|BX544891.6| Mouse DNA sequence from clone RP23-244I22 on chr... 38 2.5
8gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 36 9.9
9gb|AC140447.3| Mus musculus BAC clone RP23-53E23 from chromosome... 36 9.9
10gb|AE006841.1| Sulfolobus solfataricus P2 section 200 of 272 of ... 36 9.9
11gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, comp... 36 9.9
12gb|AC090582.9| Homo sapiens chromosome 11, clone RP11-125F14, co... 36 9.9
13ref|NM_003281.3| Homo sapiens troponin I type 1 (skeletal, slow)... 36 9.9
14emb|AL449188.2| Human DNA sequence from clone RP11-460G6 on chro... 36 9.9
15ref|XM_778427.1| PREDICTED: Strongylocentrotus purpuratus simila... 36 9.9
16emb|BX510903.2|HSM802946 Homo sapiens mRNA; cDNA DKFZp451L122 (f... 36 9.9
17emb|AL672177.9| Mouse DNA sequence from clone RP23-292D8 on chro... 36 9.9
18gb|AC090559.7| Homo sapiens chromosome 11, clone RP11-750H9, com... 36 9.9
19emb|AL831975.1|HSM803282 Homo sapiens mRNA; cDNA DKFZp451C073 (f... 36 9.9
20emb|AL831820.1|HSM803133 Homo sapiens mRNA; cDNA DKFZp451I202 (f... 36 9.9
21gb|AC096677.2| Homo sapiens chromosome 1 clone RP11-134G8, compl... 36 9.9
22dbj|AK134256.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN... 36 9.9
23gb|AC108677.4| Homo sapiens 3 BAC RP11-1P14 (Roswell Park Cancer... 36 9.9
24gb|AY028759.1| Batrachuperus taibaiensis strain MVZ231096 cytoch... 36 9.9
25gb|AY028758.1| Batrachuperus taibaiensis strain MVZ231095 cytoch... 36 9.9
26gb|AY028750.1| Batrachuperus pinchonii strain MVZ231026 cytochro... 36 9.9
27gb|AY028749.1| Batrachuperus pinchonii strain MVZ231025 cytochro... 36 9.9
28gb|AC008610.7| Homo sapiens chromosome 5 clone CTB-129O4, comple... 36 9.9
29gb|AC090943.3| Homo sapiens chromosome 3 clone RP11-22O15 map 3p... 36 9.9
30gb|AC010534.7|AC010534 Homo sapiens chromosome 16 clone RP11-259... 36 9.9
31gb|AC092337.3| Homo sapiens chromosome 16 clone RP11-21L1, compl... 36 9.9
32gb|AC008462.6|AC008462 Homo sapiens chromosome 5 clone CTC-352J1... 36 9.9
33gb|AC119427.3| Homo sapiens chromosome 1 clone RP11-27G14, compl... 36 9.9
34gb|AF248484.1|AF248484 Homo sapiens chromosome 21 PAC 30P13 map ... 36 9.9
35gb|AC091291.2| Homo sapiens chromosome 3 clone RP11-654A18 map 3... 36 9.9
36gb|AF270379.1|AF270379 Staphylococcus epidermidis strain SR1 clo... 36 9.9
37gb|AF270098.1|AF270098 Staphylococcus epidermidis strain SR1 clo... 36 9.9
38gb|AF269737.1|AF269737 Staphylococcus epidermidis strain SR1 clo... 36 9.9
39gb|AC137550.1| Homo sapiens chromosome 5 clone RP11-464K22, comp... 36 9.9
40dbj|BS000013.1| Pan troglodytes chromosome 22 clone:RP43-009O02,... 36 9.9
41gb|AF127577.2|AF127577 Homo sapiens clone PAC 270M7 chromosome 2... 36 9.9
42emb|AL163207.2|HS21C007 Homo sapiens chromosome 21 segment HS21C007 36 9.9
43emb|AJ315737.1|SSO315737 Sulfolobus solfataricus nox35 gene for ... 36 9.9
44emb|AL832006.2|HSM803313 Homo sapiens mRNA; cDNA DKFZp451O223 (f... 36 9.9
45emb|CT025676.10| Mouse DNA sequence from clone RP24-372B7 on chr... 36 9.9 
>emb|AL713860.12| Mouse DNA sequence from clone RP23-446K18 on chromosome 11 Contains the
             Ccl8 and Ccl1 genes for chemokine (C-C motif) ligand 8 and
             1, complete sequence
          Length = 129489

 Score = 40.1 bits (20), Expect = 0.64
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    tctttatatgaaaatctcac 35
             ||||||||||||||||||||
Sbjct: 99749 tctttatatgaaaatctcac 99730
to top
>emb|AL713885.1|CNS07YP2 Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone 330D23 of library Caltech CITB-BAC from chromosome
             11 of Mus musculus (mouse)
          Length = 181075

 Score = 40.1 bits (20), Expect = 0.64
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    tctttatatgaaaatctcac 35
             ||||||||||||||||||||
Sbjct: 38700 tctttatatgaaaatctcac 38681
to top
>gb|AC091257.13| Mus musculus chromosome 6, clone RP23-154A4, complete sequence
          Length = 193889

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    gagtctttatatgaaaatc 31
             |||||||||||||||||||
Sbjct: 88106 gagtctttatatgaaaatc 88088
to top
>gb|AC163682.3| Mus musculus BAC clone RP24-124O15 from chromosome 6, complete sequence
          Length = 178990

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     gagtctttatatgaaaatc 31
              |||||||||||||||||||
Sbjct: 172692 gagtctttatatgaaaatc 172674
to top
>gb|AC021810.7|AC021810 Homo sapiens chromosome 18, clone RP11-82K14, complete sequence
          Length = 192100

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    tgaaaatctcactacaaac 42
             |||||||||||||||||||
Sbjct: 78845 tgaaaatctcactacaaac 78863
to top
>gb|AC113407.2| Homo sapiens chromosome 5 clone RP11-475J5, complete sequence
          Length = 186648

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     atgaaaatctcactacaaa 41
              |||||||||||||||||||
Sbjct: 164921 atgaaaatctcactacaaa 164903
to top
>emb|BX544891.6| Mouse DNA sequence from clone RP23-244I22 on chromosome X, complete
              sequence
          Length = 185315

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 23     atgaaaatctcactacaaa 41
              |||||||||||||||||||
Sbjct: 129608 atgaaaatctcactacaaa 129626
to top
>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 14      agtctttatatgaaaatc 31
               ||||||||||||||||||
Sbjct: 2284813 agtctttatatgaaaatc 2284796
to top
>gb|AC140447.3| Mus musculus BAC clone RP23-53E23 from chromosome 9, complete sequence
          Length = 158157

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                        
Query: 19     ttatatgaaaatctcactacaaacag 44
              |||||||||||| |||||| ||||||
Sbjct: 145869 ttatatgaaaatatcactaaaaacag 145894
to top
>gb|AE006841.1| Sulfolobus solfataricus P2 section 200 of 272 of the complete genome
          Length = 10769

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 40   aacagggtaattaagtac 57
            ||||||||||||||||||
Sbjct: 6970 aacagggtaattaagtac 6987
to top
>gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, complete sequence
          Length = 189100

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 36    tacaaacagggtaattaa 53
             ||||||||||||||||||
Sbjct: 57665 tacaaacagggtaattaa 57682
to top
>gb|AC090582.9| Homo sapiens chromosome 11, clone RP11-125F14, complete sequence
          Length = 96560

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 20    tatatgaaaatctcacta 37
             ||||||||||||||||||
Sbjct: 94354 tatatgaaaatctcacta 94337
to top
>ref|NM_003281.3| Homo sapiens troponin I type 1 (skeletal, slow) (TNNI1), mRNA
          Length = 6162

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 22   tatgaaaatctcactaca 39
            ||||||||||||||||||
Sbjct: 5245 tatgaaaatctcactaca 5228
to top
>emb|AL449188.2| Human DNA sequence from clone RP11-460G6 on chromosome Xq21.2-22.2,
             complete sequence
          Length = 64329

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 18    tttatatgaaaatctcactaca 39
             ||||||||||||| ||||||||
Sbjct: 19496 tttatatgaaaatttcactaca 19475
to top
>ref|XM_778427.1| PREDICTED: Strongylocentrotus purpuratus similar to CG8385-PB,
           isoform B (LOC578243), mRNA
          Length = 1419

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 21  atatgaaaatctcactac 38
           ||||||||||||||||||
Sbjct: 956 atatgaaaatctcactac 939
to top
>emb|BX510903.2|HSM802946 Homo sapiens mRNA; cDNA DKFZp451L122 (from clone DKFZp451L122)
          Length = 5140

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 22   tatgaaaatctcactaca 39
            ||||||||||||||||||
Sbjct: 4954 tatgaaaatctcactaca 4937
to top
>emb|AL672177.9| Mouse DNA sequence from clone RP23-292D8 on chromosome 11 Contains the 3'
              end of the Gria1 gene for glutamate receptor, ionotropic,
              AMPA1 (alpha 1), complete sequence
          Length = 157692

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 13     gagtctttatatgaaaatctca 34
              ||||| ||||||||||||||||
Sbjct: 130476 gagtcgttatatgaaaatctca 130455
to top
>gb|AC090559.7| Homo sapiens chromosome 11, clone RP11-750H9, complete sequence
          Length = 202539

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 20    tatatgaaaatctcacta 37
             ||||||||||||||||||
Sbjct: 30447 tatatgaaaatctcacta 30430
to top
>emb|AL831975.1|HSM803282 Homo sapiens mRNA; cDNA DKFZp451C073 (from clone DKFZp451C073)
          Length = 5417

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 22   tatgaaaatctcactaca 39
            ||||||||||||||||||
Sbjct: 5229 tatgaaaatctcactaca 5212
to top
>emb|AL831820.1|HSM803133 Homo sapiens mRNA; cDNA DKFZp451I202 (from clone DKFZp451I202)
          Length = 5440

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 22   tatgaaaatctcactaca 39
            ||||||||||||||||||
Sbjct: 5227 tatgaaaatctcactaca 5210
to top
>gb|AC096677.2| Homo sapiens chromosome 1 clone RP11-134G8, complete sequence
          Length = 223735

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 22   tatgaaaatctcactaca 39
            ||||||||||||||||||
Sbjct: 2663 tatgaaaatctcactaca 2680
to top
>dbj|AK134256.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN full-length
           enriched library, clone:5930410P22
           product:unclassifiable, full insert sequence
          Length = 2085

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 36  tacaaacagggtaattaa 53
           ||||||||||||||||||
Sbjct: 490 tacaaacagggtaattaa 507
to top
>gb|AC108677.4| Homo sapiens 3 BAC RP11-1P14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 107650

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    ggagtctttatatgaaaa 29
             ||||||||||||||||||
Sbjct: 50863 ggagtctttatatgaaaa 50846
to top
>gb|AY028759.1| Batrachuperus taibaiensis strain MVZ231096 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 755

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 8   cgatggagtctttatatgaaaa 29
           |||||| |||||||||||||||
Sbjct: 674 cgatggcgtctttatatgaaaa 653
to top
>gb|AY028758.1| Batrachuperus taibaiensis strain MVZ231095 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 755

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 8   cgatggagtctttatatgaaaa 29
           |||||| |||||||||||||||
Sbjct: 674 cgatggcgtctttatatgaaaa 653
to top
>gb|AY028750.1| Batrachuperus pinchonii strain MVZ231026 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 755

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 8   cgatggagtctttatatgaaaa 29
           |||||| |||||||||||||||
Sbjct: 674 cgatggcgtctttatatgaaaa 653
to top
>gb|AY028749.1| Batrachuperus pinchonii strain MVZ231025 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 755

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 8   cgatggagtctttatatgaaaa 29
           |||||| |||||||||||||||
Sbjct: 674 cgatggcgtctttatatgaaaa 653
to top
>gb|AC008610.7| Homo sapiens chromosome 5 clone CTB-129O4, complete sequence
          Length = 145242

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 24     tgaaaatctcactacaaa 41
              ||||||||||||||||||
Sbjct: 123631 tgaaaatctcactacaaa 123648
to top
>gb|AC090943.3| Homo sapiens chromosome 3 clone RP11-22O15 map 3p, complete sequence
          Length = 162949

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    ctttatatgaaaatctca 34
             ||||||||||||||||||
Sbjct: 56655 ctttatatgaaaatctca 56638
to top
>gb|AC010534.7|AC010534 Homo sapiens chromosome 16 clone RP11-259E8, complete sequence
          Length = 146385

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    aaaatctcactacaaaca 43
             ||||||||||||||||||
Sbjct: 87982 aaaatctcactacaaaca 87965
to top
>gb|AC092337.3| Homo sapiens chromosome 16 clone RP11-21L1, complete sequence
          Length = 175994

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 26     aaaatctcactacaaaca 43
              ||||||||||||||||||
Sbjct: 140352 aaaatctcactacaaaca 140335
to top
>gb|AC008462.6|AC008462 Homo sapiens chromosome 5 clone CTC-352J10, complete sequence
          Length = 183591

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    ttatatgaaaatctcact 36
             ||||||||||||||||||
Sbjct: 25594 ttatatgaaaatctcact 25577
to top
>gb|AC119427.3| Homo sapiens chromosome 1 clone RP11-27G14, complete sequence
          Length = 181148

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     tatgaaaatctcactaca 39
              ||||||||||||||||||
Sbjct: 157683 tatgaaaatctcactaca 157700
to top
>gb|AF248484.1|AF248484 Homo sapiens chromosome 21 PAC 30P13 map 21q11.2, complete sequence,
              containing gene for nuclear factor RIP140
          Length = 148131

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 33     cactacaaacagggtaattaag 54
              ||||| ||||||||||||||||
Sbjct: 120640 cactagaaacagggtaattaag 120619
to top
>gb|AC091291.2| Homo sapiens chromosome 3 clone RP11-654A18 map 3p, complete sequence
          Length = 184579

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    ctttatatgaaaatctca 34
             ||||||||||||||||||
Sbjct: 14178 ctttatatgaaaatctca 14161
to top
>gb|AF270379.1|AF270379 Staphylococcus epidermidis strain SR1 clone step.4033c10 genomic
          sequence
          Length = 1609

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 17 ctttatatgaaaatctca 34
          ||||||||||||||||||
Sbjct: 16 ctttatatgaaaatctca 33
to top
>gb|AF270098.1|AF270098 Staphylococcus epidermidis strain SR1 clone step.1048g07 genomic
            sequence
          Length = 3379

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 17   ctttatatgaaaatctca 34
            ||||||||||||||||||
Sbjct: 2988 ctttatatgaaaatctca 2971
to top
>gb|AF269737.1|AF269737 Staphylococcus epidermidis strain SR1 clone step.1020g09 genomic
           sequence
          Length = 2858

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  ctttatatgaaaatctca 34
           ||||||||||||||||||
Sbjct: 411 ctttatatgaaaatctca 428
to top
>gb|AC137550.1| Homo sapiens chromosome 5 clone RP11-464K22, complete sequence
          Length = 43879

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 24   tgaaaatctcactacaaa 41
            ||||||||||||||||||
Sbjct: 9159 tgaaaatctcactacaaa 9176
to top
>dbj|BS000013.1| Pan troglodytes chromosome 22 clone:RP43-009O02, map 22, complete
             sequences
          Length = 180661

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 33    cactacaaacagggtaattaag 54
             ||||| ||||||||||||||||
Sbjct: 81893 cactagaaacagggtaattaag 81872
to top
>gb|AF127577.2|AF127577 Homo sapiens clone PAC 270M7 chromosome 21 map 21q11.2, complete
             sequence
          Length = 168153

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 33    cactacaaacagggtaattaag 54
             ||||| ||||||||||||||||
Sbjct: 43741 cactagaaacagggtaattaag 43720
to top
>emb|AL163207.2|HS21C007 Homo sapiens chromosome 21 segment HS21C007
          Length = 340000

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 33     cactacaaacagggtaattaag 54
              ||||| ||||||||||||||||
Sbjct: 302664 cactagaaacagggtaattaag 302643
to top
>emb|AJ315737.1|SSO315737 Sulfolobus solfataricus nox35 gene for NADH oxidase/thioredoxin
           reductase
          Length = 1734

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 40  aacagggtaattaagtac 57
           ||||||||||||||||||
Sbjct: 373 aacagggtaattaagtac 390
to top
>emb|AL832006.2|HSM803313 Homo sapiens mRNA; cDNA DKFZp451O223 (from clone DKFZp451O223)
          Length = 4862

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 22   tatgaaaatctcactaca 39
            ||||||||||||||||||
Sbjct: 3945 tatgaaaatctcactaca 3928
to top
>emb|CT025676.10| Mouse DNA sequence from clone RP24-372B7 on chromosome 9, complete
              sequence
          Length = 174177

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                        
Query: 19     ttatatgaaaatctcactacaaacag 44
              |||||||||||| |||||| ||||||
Sbjct: 141966 ttatatgaaaatatcactaaaaacag 141941


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 553,299
Number of Sequences: 3902068
Number of extensions: 553299
Number of successful extensions: 34405
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34331
Number of HSP's gapped (non-prelim): 74
length of query: 66
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 45
effective length of database: 17,151,101,840
effective search space: 771799582800
effective search space used: 771799582800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top