ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl56b03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|DP000016.1| Pan troglodytes target 1 genomic scaffold 46 0.075
2gb|AC087512.2| Pan troglodytes clone RP43-144M20, complete sequence 46 0.075
3gb|AC147106.2| Pan troglodytes BAC clone RP43-15F7 from 7, compl... 46 0.075
4gb|AC146205.2| Pan troglodytes BAC clone RP43-34B6 from 7, compl... 46 0.075
5emb|BX927225.7| Zebrafish DNA sequence from clone CH211-106F9 in... 42 1.2
6emb|AL035475.7|PFMAL4P2 Plasmodium falciparum MAL4P2 42 1.2
7emb|AL109614.28|HSBA425M5 Human DNA sequence from clone RP11-425... 40 4.6
8emb|AL935257.1| Lactobacillus plantarum strain WCFS1 complete ge... 40 4.6
9gb|AC007187.5| Arabidopsis thaliana chromosome 2 clone F7E22 map... 40 4.6
10gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequ... 40 4.6
11gb|AC154323.3| Mus musculus BAC clone RP23-307K19 from chromosom... 40 4.6
12gb|AC073616.17| Homo sapiens 12 BAC RP3-361K10 (Roswell Park Can... 40 4.6
13gb|AC009306.5| Homo sapiens BAC clone RP11-290K24 from 2, comple... 40 4.6
14gb|AC154407.2| Mus musculus BAC clone RP24-257B4 from 14, comple... 40 4.6
15emb|BX000990.6| Mouse DNA sequence from clone RP23-128J19 on chr... 40 4.6
16emb|AL672222.11| Mouse DNA sequence from clone RP23-330A15 on ch... 40 4.6
17emb|AL772293.7| Mouse DNA sequence from clone RP23-57D24 on chro... 40 4.6 
>gb|DP000016.1| Pan troglodytes target 1 genomic scaffold
          Length = 1623484

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 134    gttacatagactcaaaaacatataaat 160
              |||||||||||| ||||||||||||||
Sbjct: 274055 gttacatagacttaaaaacatataaat 274029
to top
>gb|AC087512.2| Pan troglodytes clone RP43-144M20, complete sequence
          Length = 120797

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 134   gttacatagactcaaaaacatataaat 160
             |||||||||||| ||||||||||||||
Sbjct: 63233 gttacatagacttaaaaacatataaat 63207
to top
>gb|AC147106.2| Pan troglodytes BAC clone RP43-15F7 from 7, complete sequence
          Length = 193107

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 134    gttacatagactcaaaaacatataaat 160
              |||||||||||| ||||||||||||||
Sbjct: 151352 gttacatagacttaaaaacatataaat 151378
to top
>gb|AC146205.2| Pan troglodytes BAC clone RP43-34B6 from 7, complete sequence
          Length = 187725

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 134   gttacatagactcaaaaacatataaat 160
             |||||||||||| ||||||||||||||
Sbjct: 74261 gttacatagacttaaaaacatataaat 74235
to top
>emb|BX927225.7| Zebrafish DNA sequence from clone CH211-106F9 in linkage group 6,
             complete sequence
          Length = 161068

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 132   cagttacatagactcaaaaac 152
             |||||||||||||||||||||
Sbjct: 51898 cagttacatagactcaaaaac 51878
to top
>emb|AL035475.7|PFMAL4P2 Plasmodium falciparum MAL4P2
          Length = 234081

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 146    caaaaacatataaattaatta 166
              |||||||||||||||||||||
Sbjct: 179133 caaaaacatataaattaatta 179153
to top
>emb|AL109614.28|HSBA425M5 Human DNA sequence from clone RP11-425M5 on chromosome 20 Contains the
              GLRXP gene for glutaredoxin (thioltransferase) pseudogene,
              the PPIAP3 gene for peptidylprolyl isomerase A (cyclophilin
              A) pseudogene 3, the NNAT gene for neuronatin, the BLCAP
              gene for bladder cancer 10 kD protein BC10, a novel gene
              and three CpG islands, complete sequence
          Length = 194433

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 50     aaatacccagagttcttaca 69
              ||||||||||||||||||||
Sbjct: 157260 aaatacccagagttcttaca 157241
to top
>emb|AL935257.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 6/11
          Length = 302050

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 145   tcaaaaacatataaattaattata 168
             ||||||||| ||||||||||||||
Sbjct: 22734 tcaaaaacagataaattaattata 22711
to top
>gb|AC007187.5| Arabidopsis thaliana chromosome 2 clone F7E22 map mi421, complete
             sequence
          Length = 98432

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 141   agactcaaaaacatataaattaat 164
             ||||| ||||||||||||||||||
Sbjct: 15066 agacttaaaaacatataaattaat 15043
to top
>gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequence
          Length = 124024

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 148   aaaacatataaattaattat 167
             ||||||||||||||||||||
Sbjct: 42065 aaaacatataaattaattat 42046
to top
>gb|AC154323.3| Mus musculus BAC clone RP23-307K19 from chromosome 14, complete
            sequence
          Length = 191902

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 260  tttggtacatttattattca 279
            ||||||||||||||||||||
Sbjct: 4673 tttggtacatttattattca 4654
to top
>gb|AC073616.17| Homo sapiens 12 BAC RP3-361K10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 128936

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 209   ccacaggtgtggatgtaattacta 232
             |||||| |||||||||||||||||
Sbjct: 64163 ccacagatgtggatgtaattacta 64186
to top
>gb|AC009306.5| Homo sapiens BAC clone RP11-290K24 from 2, complete sequence
          Length = 176602

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   aaacatataaattaattata 168
             ||||||||||||||||||||
Sbjct: 66327 aaacatataaattaattata 66346
to top
>gb|AC154407.2| Mus musculus BAC clone RP24-257B4 from 14, complete sequence
          Length = 158436

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 260   tttggtacatttattattca 279
             ||||||||||||||||||||
Sbjct: 47934 tttggtacatttattattca 47953
to top
>emb|BX000990.6| Mouse DNA sequence from clone RP23-128J19 on chromosome X, complete
             sequence
          Length = 19228

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 147   aaaaacatataaattaatta 166
             ||||||||||||||||||||
Sbjct: 19038 aaaaacatataaattaatta 19019
to top
>emb|AL672222.11| Mouse DNA sequence from clone RP23-330A15 on chromosome X, complete
            sequence
          Length = 194025

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 147  aaaaacatataaattaatta 166
            ||||||||||||||||||||
Sbjct: 1810 aaaaacatataaattaatta 1791
to top
>emb|AL772293.7| Mouse DNA sequence from clone RP23-57D24 on chromosome 4, complete
              sequence
          Length = 251930

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 148    aaaacatataaattaattat 167
              ||||||||||||||||||||
Sbjct: 194495 aaaacatataaattaattat 194476


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,823,034
Number of Sequences: 3902068
Number of extensions: 3823034
Number of successful extensions: 74273
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74227
Number of HSP's gapped (non-prelim): 46
length of query: 348
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 326
effective length of database: 17,147,199,772
effective search space: 5589987125672
effective search space used: 5589987125672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top