>ref|XM_499609.1| Yarrowia lipolytica CLIB122, YALI0A00264g predicted mRNA
          Length = 3243

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 43   aaacctcctcggaagacagct 63
            |||||||||||||||||||||
Sbjct: 2788 aaacctcctcggaagacagct 2768

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia
             lipolytica
          Length = 2303261

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 43    aaacctcctcggaagacagct 63
             |||||||||||||||||||||
Sbjct: 24801 aaacctcctcggaagacagct 24821

>emb|AL669954.6| Mouse DNA sequence from clone RP23-456O18 on chromosome 11 Contains the
             3' end of the Rai1 gene for retinoic acid induced 1, the
             Srebf1 gene for sterol regulatory element binding factor
             1, the 3' end of the gene for the likely ortholog of H.
             sapiens target of myb1-like 2 (chicken) (TOM1L2)
             (A730055F12Rik), a novel gene and two CpG islands,
             complete sequence
          Length = 119279

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    aacctcctcggaagacagct 63
             ||||||||||||||||||||
Sbjct: 16715 aacctcctcggaagacagct 16696

>gb|AC096624.23| Mus musculus strain C57BL/6J chromosome 11 clone rp23-326m22, complete
              sequence
          Length = 227682

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     aacctcctcggaagacagct 63
              ||||||||||||||||||||
Sbjct: 116200 aacctcctcggaagacagct 116219

>gb|AC114674.10| Mus musculus chromosome 9, clone RP24-209N21, complete sequence
          Length = 203120

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 84    tagcctccaagctatacag 102
             |||||||||||||||||||
Sbjct: 58192 tagcctccaagctatacag 58210

>dbj|AP000829.4| Homo sapiens genomic DNA, chromosome 18p clone:RP11-732L14, complete
              sequences
          Length = 186383

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 83     atagcctccaagctataca 101
              |||||||||||||||||||
Sbjct: 122044 atagcctccaagctataca 122026


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 794,046
Number of Sequences: 3902068
Number of extensions: 794046
Number of successful extensions: 41396
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41385
Number of HSP's gapped (non-prelim): 11
length of query: 133
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 112
effective length of database: 17,151,101,840
effective search space: 1920923406080
effective search space used: 1920923406080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)