ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl56a02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 153 5e-34
2dbj|AP003224.3| Oryza sativa (japonica cultivar-group) genomic D... 153 5e-34
3ref|XM_463460.1| Oryza sativa (japonica cultivar-group), predic... 149 8e-33
4gb|AY109443.1| Zea mays CL3420_1 mRNA sequence 145 1e-31
5dbj|AK100383.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 5e-31
6ref|XM_463457.1| Oryza sativa (japonica cultivar-group), predic... 139 7e-30
7ref|XM_320774.2| Anopheles gambiae str. PEST ENSANGP00000014036 ... 44 0.32
8gb|AC002429.1| Homo sapiens BAC clone GS1-200K5 from 7, complete... 42 1.3
9emb|CR956421.19| Pig DNA sequence from clone PigE-225A14 on chro... 42 1.3
10gb|AC153608.10| Mus musculus 6 BAC RP23-79A7 (Roswell Park Cance... 40 5.0
11gb|AC146865.11| Medicago truncatula clone mth2-36m14, complete s... 40 5.0
12emb|AL590705.9| Human DNA sequence from clone RP11-498P14 on chr... 40 5.0
13emb|AL354915.5| Human DNA sequence from clone RP11-392A19 on chr... 40 5.0
14emb|AL139008.10| Human DNA sequence from clone RP11-255A11 on ch... 40 5.0
15emb|AJ242954.1|MMU242954 Mus musculus partial mRNA for dysferlin... 40 5.0
16emb|BX890609.7| Zebrafish DNA sequence from clone DKEY-56E5, com... 40 5.0
17gb|AC157557.5| Mus musculus chromosome 7, clone RP24-369M22, com... 40 5.0
18dbj|AK087986.1| Mus musculus 2 days neonate thymus thymic cells ... 40 5.0
19gb|AC092492.1|AC092492 Drosophila melanogaster, chromosome 2L, r... 40 5.0
20gb|BC043692.1| Mus musculus dysferlin, mRNA (cDNA clone IMAGE:51... 40 5.0
21gb|AC016751.7| Homo sapiens BAC clone RP11-504O20 from 2, comple... 40 5.0
22gb|AF011889.1|AF011889 Human Xq28 cosmids U126G1, U142F2, U69B6,... 40 5.0
23ref|XM_232123.3| PREDICTED: Rattus norvegicus dysferlin (predict... 40 5.0
24dbj|AK131144.1| Mus musculus mRNA for mFLJ00175 protein 40 5.0
25emb|AL929242.16| Mouse DNA sequence from clone RP23-78D16 on chr... 40 5.0
26emb|CT574592.2| Pan troglodytes chromosome X clone PTB-082B15 ma... 40 5.0
27gb|AE003624.3| Drosophila melanogaster chromosome 2L, section 33... 40 5.0
28gb|AC099643.5| Mus musculus chromosome 7, clone RP24-350G1, comp... 40 5.0 
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  153 bits (77), Expect = 5e-34
 Identities = 158/185 (85%)
 Strand = Plus / Minus

                                                                            
Query: 170      tgtcagtccattgtgatccggcctggacctcccttcagcgagcggtgcagaggccgtgat 229
                |||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||  |||
Sbjct: 32987631 tgtcagtccattgtgatccggcctggccctcccttcagtgagcggtacagaggcctggat 32987572

                                                                            
Query: 230      cgcttgaagccgaatatgtcggtaatccggcaagttttgggcaggtcatcctcggcgatc 289
                |||||||||||||||||||| || || ||| ||||||||||    ||| | ||||| || 
Sbjct: 32987571 cgcttgaagccgaatatgtcagtgattcggtaagttttgggtgcatcagcttcggcaata 32987512

                                                                            
Query: 290      gccttcttgaactctgccgaatggttgccgctgaagacctgcacgctcactgtcctcctt 349
                ||||||||||| |||||| |||| ||||||| |||||| || ||||| | |||| ||| |
Sbjct: 32987511 gccttcttgaattctgccaaatgtttgccgccgaagacttgtacgcttaatgtcttccgt 32987452

                     
Query: 350      tgagg 354
                |||||
Sbjct: 32987451 tgagg 32987447



 Score =  143 bits (72), Expect = 5e-31
 Identities = 159/188 (84%)
 Strand = Plus / Minus

                                                                            
Query: 170      tgtcagtccattgtgatccggcctggacctcccttcagcgagcggtgcagaggccgtgat 229
                |||||||||||||||||||||||||| ||||||||||| ||||||| || ||| |  |||
Sbjct: 32969862 tgtcagtccattgtgatccggcctggccctcccttcagtgagcggtacaaaggtctggat 32969803

                                                                            
Query: 230      cgcttgaagccgaatatgtcggtaatccggcaagttttgggcaggtcatcctcggcgatc 289
                |||||||||||||||||||| || || ||| ||||||||||    ||| | || || || 
Sbjct: 32969802 cgcttgaagccgaatatgtcagtgattcggtaagttttgggtgtatcagcttcagcaatg 32969743

                                                                            
Query: 290      gccttcttgaactctgccgaatggttgccgctgaagacctgcacgctcactgtcctcctt 349
                |||||||||||||||||| |||| | ||||| |||||| |||||||| || ||  |||||
Sbjct: 32969742 gccttcttgaactctgccaaatgttcgccgccgaagacttgcacgcttacagttttcctt 32969683

                        
Query: 350      tgaggggc 357
                ||||||||
Sbjct: 32969682 tgaggggc 32969675
to top
>dbj|AP003224.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0010B10
          Length = 155263

 Score =  153 bits (77), Expect = 5e-34
 Identities = 158/185 (85%)
 Strand = Plus / Minus

                                                                         
Query: 170   tgtcagtccattgtgatccggcctggacctcccttcagcgagcggtgcagaggccgtgat 229
             |||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||  |||
Sbjct: 53859 tgtcagtccattgtgatccggcctggccctcccttcagtgagcggtacagaggcctggat 53800

                                                                         
Query: 230   cgcttgaagccgaatatgtcggtaatccggcaagttttgggcaggtcatcctcggcgatc 289
             |||||||||||||||||||| || || ||| ||||||||||    ||| | ||||| || 
Sbjct: 53799 cgcttgaagccgaatatgtcagtgattcggtaagttttgggtgcatcagcttcggcaata 53740

                                                                         
Query: 290   gccttcttgaactctgccgaatggttgccgctgaagacctgcacgctcactgtcctcctt 349
             ||||||||||| |||||| |||| ||||||| |||||| || ||||| | |||| ||| |
Sbjct: 53739 gccttcttgaattctgccaaatgtttgccgccgaagacttgtacgcttaatgtcttccgt 53680

                  
Query: 350   tgagg 354
             |||||
Sbjct: 53679 tgagg 53675



 Score =  143 bits (72), Expect = 5e-31
 Identities = 159/188 (84%)
 Strand = Plus / Minus

                                                                         
Query: 170   tgtcagtccattgtgatccggcctggacctcccttcagcgagcggtgcagaggccgtgat 229
             |||||||||||||||||||||||||| ||||||||||| ||||||| || ||| |  |||
Sbjct: 36090 tgtcagtccattgtgatccggcctggccctcccttcagtgagcggtacaaaggtctggat 36031

                                                                         
Query: 230   cgcttgaagccgaatatgtcggtaatccggcaagttttgggcaggtcatcctcggcgatc 289
             |||||||||||||||||||| || || ||| ||||||||||    ||| | || || || 
Sbjct: 36030 cgcttgaagccgaatatgtcagtgattcggtaagttttgggtgtatcagcttcagcaatg 35971

                                                                         
Query: 290   gccttcttgaactctgccgaatggttgccgctgaagacctgcacgctcactgtcctcctt 349
             |||||||||||||||||| |||| | ||||| |||||| |||||||| || ||  |||||
Sbjct: 35970 gccttcttgaactctgccaaatgttcgccgccgaagacttgcacgcttacagttttcctt 35911

                     
Query: 350   tgaggggc 357
             ||||||||
Sbjct: 35910 tgaggggc 35903
to top
>ref|XM_463460.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2838

 Score =  149 bits (75), Expect = 8e-33
 Identities = 156/183 (85%)
 Strand = Plus / Minus

                                                                        
Query: 172  tcagtccattgtgatccggcctggacctcccttcagcgagcggtgcagaggccgtgatcg 231
            |||||||||||||||||||||||| ||||||||||| ||||||| ||||||||  |||||
Sbjct: 2838 tcagtccattgtgatccggcctggccctcccttcagtgagcggtacagaggcctggatcg 2779

                                                                        
Query: 232  cttgaagccgaatatgtcggtaatccggcaagttttgggcaggtcatcctcggcgatcgc 291
            |||||||||||||||||| || || ||| ||||||||||    ||| | ||||| || ||
Sbjct: 2778 cttgaagccgaatatgtcagtgattcggtaagttttgggtgcatcagcttcggcaatagc 2719

                                                                        
Query: 292  cttcttgaactctgccgaatggttgccgctgaagacctgcacgctcactgtcctcctttg 351
            ||||||||| |||||| |||| ||||||| |||||| || ||||| | |||| ||| |||
Sbjct: 2718 cttcttgaattctgccaaatgtttgccgccgaagacttgtacgcttaatgtcttccgttg 2659

               
Query: 352  agg 354
            |||
Sbjct: 2658 agg 2656
to top
>gb|AY109443.1| Zea mays CL3420_1 mRNA sequence
          Length = 1424

 Score =  145 bits (73), Expect = 1e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 170 tgtcagtccattgtgatccggcctggacctcccttcagcgagcggtgcagaggccgtgat 229
           ||||||||||| ||||||| ||| ||||||||||| || |||| || ||| ||||  |||
Sbjct: 159 tgtcagtccatggtgatcctgcccggacctcccttgagtgagctgtacagcggcctcgat 218

                                                                       
Query: 230 cgcttgaagccgaatatgtcggtaatccggcaagttttgggcaggtcatcctcggcgatc 289
           || ||||||||||||||||| ||||| | | |  |||||||| ||||  | |||  ||| 
Sbjct: 219 cgtttgaagccgaatatgtctgtaattctgtacattttgggcgggtcggcttcgttgatt 278

                                                                       
Query: 290 gccttcttgaactctgccgaatggttgccgctgaagacctgcacgctcactgtcctcctt 349
           ||||||||||||||| || |||||||||||| |||||| |||||||| | ||||||||||
Sbjct: 279 gccttcttgaactctaccaaatggttgccgccgaagacttgcacgcttagtgtcctcctt 338

                                    
Query: 350 tgaggggcgtccacctttatgtact 374
           ||||| |||||||| ||||| ||||
Sbjct: 339 tgaggcgcgtccacttttatatact 363
to top
>dbj|AK100383.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023085G23, full
            insert sequence
          Length = 3262

 Score =  143 bits (72), Expect = 5e-31
 Identities = 159/188 (84%)
 Strand = Plus / Minus

                                                                        
Query: 170  tgtcagtccattgtgatccggcctggacctcccttcagcgagcggtgcagaggccgtgat 229
            |||||||||||||||||||||||||| ||||||||||| ||||||| || ||| |  |||
Sbjct: 3047 tgtcagtccattgtgatccggcctggccctcccttcagtgagcggtacaaaggtctggat 2988

                                                                        
Query: 230  cgcttgaagccgaatatgtcggtaatccggcaagttttgggcaggtcatcctcggcgatc 289
            |||||||||||||||||||| || || ||| ||||||||||    ||| | || || || 
Sbjct: 2987 cgcttgaagccgaatatgtcagtgattcggtaagttttgggtgtatcagcttcagcaatg 2928

                                                                        
Query: 290  gccttcttgaactctgccgaatggttgccgctgaagacctgcacgctcactgtcctcctt 349
            |||||||||||||||||| |||| | ||||| |||||| |||||||| || ||  |||||
Sbjct: 2927 gccttcttgaactctgccaaatgttcgccgccgaagacttgcacgcttacagttttcctt 2868

                    
Query: 350  tgaggggc 357
            ||||||||
Sbjct: 2867 tgaggggc 2860
to top
>ref|XM_463457.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2841

 Score =  139 bits (70), Expect = 7e-30
 Identities = 157/186 (84%)
 Strand = Plus / Minus

                                                                        
Query: 172  tcagtccattgtgatccggcctggacctcccttcagcgagcggtgcagaggccgtgatcg 231
            |||||||||||||||||||||||| ||||||||||| ||||||| || ||| |  |||||
Sbjct: 2841 tcagtccattgtgatccggcctggccctcccttcagtgagcggtacaaaggtctggatcg 2782

                                                                        
Query: 232  cttgaagccgaatatgtcggtaatccggcaagttttgggcaggtcatcctcggcgatcgc 291
            |||||||||||||||||| || || ||| ||||||||||    ||| | || || || ||
Sbjct: 2781 cttgaagccgaatatgtcagtgattcggtaagttttgggtgtatcagcttcagcaatggc 2722

                                                                        
Query: 292  cttcttgaactctgccgaatggttgccgctgaagacctgcacgctcactgtcctcctttg 351
            |||||||||||||||| |||| | ||||| |||||| |||||||| || ||  |||||||
Sbjct: 2721 cttcttgaactctgccaaatgttcgccgccgaagacttgcacgcttacagttttcctttg 2662

                  
Query: 352  aggggc 357
            ||||||
Sbjct: 2661 aggggc 2656
to top
>ref|XM_320774.2| Anopheles gambiae str. PEST ENSANGP00000014036
           (ENSANGG00000011547), partial mRNA
          Length = 1506

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 276 catcctcggcgatcgccttcttgaac 301
           |||||||||||||||||||| |||||
Sbjct: 634 catcctcggcgatcgccttcgtgaac 609
to top
>gb|AC002429.1| Homo sapiens BAC clone GS1-200K5 from 7, complete sequence
          Length = 234053

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 98     gagaaaaatcaatcaaaattg 118
              |||||||||||||||||||||
Sbjct: 121168 gagaaaaatcaatcaaaattg 121188
to top
>emb|CR956421.19| Pig DNA sequence from clone PigE-225A14 on chromosome 6, complete
             sequence
          Length = 127959

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 98    gagaaaaatcaatcaaaattg 118
             |||||||||||||||||||||
Sbjct: 73150 gagaaaaatcaatcaaaattg 73170
to top
>gb|AC153608.10| Mus musculus 6 BAC RP23-79A7 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 188294

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 187   ccggcctggacctcccttca 206
             ||||||||||||||||||||
Sbjct: 79761 ccggcctggacctcccttca 79780
to top
>gb|AC146865.11| Medicago truncatula clone mth2-36m14, complete sequence
          Length = 128493

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 99    agaaaaatcaatcaaaattg 118
             ||||||||||||||||||||
Sbjct: 72527 agaaaaatcaatcaaaattg 72508
to top
>emb|AL590705.9| Human DNA sequence from clone RP11-498P14 on chromosome 9 Contains four
              novel genes, a novel gene similar to FLJ23393. the 5' end
              of a novel gene (KIAA1529) and two CpG islands, complete
              sequence
          Length = 130244

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    aatcaatcaaaattgggttc 123
              ||||||||||||||||||||
Sbjct: 104751 aatcaatcaaaattgggttc 104770
to top
>emb|AL354915.5| Human DNA sequence from clone RP11-392A19 on chromosome 13 Contains a
              novel pseudogene and a keratin 18 (KRT18) (K18, CYK18)
              pseudogene, complete sequence
          Length = 156442

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 99     agaaaaatcaatcaaaattg 118
              ||||||||||||||||||||
Sbjct: 103271 agaaaaatcaatcaaaattg 103252
to top
>emb|AL139008.10| Human DNA sequence from clone RP11-255A11 on chromosome 9 Contains
            four novel genes, the gene for a novel protein similar to
            suppressor of G2 allele of SKP1 homolog, the gene for a
            novel protein similar to KIAA1074, a melanoma antigen
            pseudogene, a sorting nexin 18 (SNX18) pseudogene, a
            trypsin domain pseudogene, two genes for novel
            immunoglobulin domain containing proteins, the gene for a
            novel protein similar to annexin A2 (ANXA2), the gene for
            a novel protein similar to T-cell receptor beta chain V
            region proteins, a T-cell receptor beta chain V region
            protein LB2 pseudogene and two CpG islands, complete
            sequence
          Length = 159974

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 104  aatcaatcaaaattgggttc 123
            ||||||||||||||||||||
Sbjct: 3979 aatcaatcaaaattgggttc 3960
to top
>emb|AJ242954.1|MMU242954 Mus musculus partial mRNA for dysferlin (dysf gene)
          Length = 5078

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 187  ccggcctggacctcccttca 206
            ||||||||||||||||||||
Sbjct: 3995 ccggcctggacctcccttca 4014
to top
>emb|BX890609.7| Zebrafish DNA sequence from clone DKEY-56E5, complete sequence
          Length = 228713

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 103   aaatcaatcaaaattgggttcatg 126
             ||||||| ||||||||||||||||
Sbjct: 87668 aaatcaaacaaaattgggttcatg 87691
to top
>gb|AC157557.5| Mus musculus chromosome 7, clone RP24-369M22, complete sequence
          Length = 202543

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 98    gagaaaaatcaatcaaaatt 117
             ||||||||||||||||||||
Sbjct: 32444 gagaaaaatcaatcaaaatt 32425
to top
>dbj|AK087986.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:E430001M20
            product:dysferlin, full insert sequence
          Length = 2533

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 187  ccggcctggacctcccttca 206
            ||||||||||||||||||||
Sbjct: 1449 ccggcctggacctcccttca 1468
to top
>gb|AC092492.1|AC092492 Drosophila melanogaster, chromosome 2L, region 30B-30E, BAC clone
              BACR20B09, complete sequence
          Length = 177997

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 100    gaaaaatcaatcaaaattgggttc 123
              ||||||||||||||||||| ||||
Sbjct: 145734 gaaaaatcaatcaaaattgtgttc 145711
to top
>gb|BC043692.1| Mus musculus dysferlin, mRNA (cDNA clone IMAGE:5150289), partial
           cds
          Length = 2046

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 ccggcctggacctcccttca 206
           ||||||||||||||||||||
Sbjct: 949 ccggcctggacctcccttca 968
to top
>gb|AC016751.7| Homo sapiens BAC clone RP11-504O20 from 2, complete sequence
          Length = 176379

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 99    agaaaaatcaatcaaaattg 118
             ||||||||||||||||||||
Sbjct: 45960 agaaaaatcaatcaaaattg 45941
to top
>gb|AF011889.1|AF011889 Human Xq28 cosmids U126G1, U142F2, U69B6, U145C10, U169A5, U84H1, U24D12,
              U80A7, U153E6, L35485, and R7-163A8 containing iduronate
              2-sulfatase gene and pseudogene, complete sequence
          Length = 326663

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 99     agaaaaatcaatcaaaattg 118
              ||||||||||||||||||||
Sbjct: 154108 agaaaaatcaatcaaaattg 154127
to top
>ref|XM_232123.3| PREDICTED: Rattus norvegicus dysferlin (predicted) (Dysf_predicted),
            mRNA
          Length = 6810

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 187  ccggcctggacctcccttca 206
            ||||||||||||||||||||
Sbjct: 5673 ccggcctggacctcccttca 5692
to top
>dbj|AK131144.1| Mus musculus mRNA for mFLJ00175 protein
          Length = 6660

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 187  ccggcctggacctcccttca 206
            ||||||||||||||||||||
Sbjct: 5574 ccggcctggacctcccttca 5593
to top
>emb|AL929242.16| Mouse DNA sequence from clone RP23-78D16 on chromosome 2, complete
              sequence
          Length = 217352

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 319    gctgaagacctgcacgctcactgt 342
              ||||||||||||| ||||||||||
Sbjct: 175662 gctgaagacctgcccgctcactgt 175685
to top
>emb|CT574592.2| Pan troglodytes chromosome X clone PTB-082B15 map Xq28, complete sequence
          Length = 228540

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 99     agaaaaatcaatcaaaattg 118
              ||||||||||||||||||||
Sbjct: 115205 agaaaaatcaatcaaaattg 115224
to top
>gb|AE003624.3| Drosophila melanogaster chromosome 2L, section 33 of 83 of the complete
              sequence
          Length = 270771

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 100    gaaaaatcaatcaaaattgggttc 123
              ||||||||||||||||||| ||||
Sbjct: 199509 gaaaaatcaatcaaaattgtgttc 199486
to top
>gb|AC099643.5| Mus musculus chromosome 7, clone RP24-350G1, complete sequence
          Length = 139303

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 98    gagaaaaatcaatcaaaatt 117
             ||||||||||||||||||||
Sbjct: 15634 gagaaaaatcaatcaaaatt 15615


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,577,106
Number of Sequences: 3902068
Number of extensions: 2577106
Number of successful extensions: 49218
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49168
Number of HSP's gapped (non-prelim): 46
length of query: 374
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 352
effective length of database: 17,147,199,772
effective search space: 6035814319744
effective search space used: 6035814319744
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top