>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  281 bits (142), Expect = 9e-73
 Identities = 262/302 (86%)
 Strand = Plus / Minus

                                                                           
Query: 125     tcagcttcagcaaaaccataggagctgaagtgcttcaccttgaacttccactcgccctta 184
               ||||||||| |||| |||||||||||||| ||||| ||| |||| |||||||||||||| 
Sbjct: 3343077 tcagcttcaccaaagccataggagctgaaatgcttgaccctgaatttccactcgcccttg 3343018

                                                                           
Query: 185     gcagcgtcaaacgagatgaactccacaccctgctcctcagccttcttcaccagcatctcc 244
               ||||| || || |||||||||||  |||||||||||||||||||||||||||| ||||||
Sbjct: 3343017 gcagcatcgaatgagatgaactcagcaccctgctcctcagccttcttcaccagtatctcc 3342958

                                                                           
Query: 245     ttgtacttgtccacccttggaccctccgtgtatggctcgcttgtcttcctgttaacacac 304
               ||||||||| ||||||| |||||||| |||||  |||| |  |||||| |||| |  |||
Sbjct: 3342957 ttgtacttgcccaccctcggaccctctgtgtactgctcccccgtcttcttgttcatgcac 3342898

                                                                           
Query: 305     ttgatgttcagaagagtcaccacagcagctttgttcaggccctcgccaaccgggggcttc 364
               ||||| || ||||| |||||||| |||||||| ||||| ||||| ||||| |||||||||
Sbjct: 3342897 ttgatattgagaagggtcaccacggcagctttattcagaccctcaccaacagggggcttc 3342838

                                                                           
Query: 365     tcgttatcatccttgtacacaatcacttcacggttattgaattccacgatcgattccaga 424
               | | |||| ||||||||||| |||||||||||||||||||||||||| || || ||||||
Sbjct: 3342837 ttgctatcgtccttgtacacgatcacttcacggttattgaattccacaatggactccaga 3342778

                 
Query: 425     tc 426
               ||
Sbjct: 3342777 tc 3342776



 Score =  260 bits (131), Expect = 3e-66
 Identities = 260/303 (85%)
 Strand = Plus / Minus

                                                                           
Query: 124     ttcagcttcagcaaaaccataggagctgaagtgcttcaccttgaacttccactcgccctt 183
               |||||||||| |||| |||||||||||||| ||||| ||| |||| ||||||||||| ||
Sbjct: 3351813 ttcagcttcaccaaagccataggagctgaaatgcttgaccctgaatttccactcgccatt 3351754

                                                                           
Query: 184     agcagcgtcaaacgagatgaactccacaccctgctcctcagccttcttcaccagcatctc 243
                 | || || || |||||||||||  |||||||||||||||| |||||||||||||||||
Sbjct: 3351753 gacggcatcgaaagagatgaactcagcaccctgctcctcagctttcttcaccagcatctc 3351694

                                                                           
Query: 244     cttgtacttgtccacccttggaccctccgtgtatggctcgcttgtcttcctgttaacaca 303
               |||||||||||||||||| |||||||| |||||  | || |  |||||| |||| |  ||
Sbjct: 3351693 cttgtacttgtccaccctcggaccctctgtgtactgatcccccgtcttcttgttcatgca 3351634

                                                                           
Query: 304     cttgatgttcagaagagtcaccacagcagctttgttcaggccctcgccaaccgggggctt 363
               |||||| || ||||| |||||||| |||||||| ||||| ||||| ||||| ||||||||
Sbjct: 3351633 cttgatattgagaagggtcaccacggcagctttattcagaccctcaccaacagggggctt 3351574

                                                                           
Query: 364     ctcgttatcatccttgtacacaatcacttcacggttattgaattccacgatcgattccag 423
               || | |||| ||||||||||| |||||||||||||||||||||||||| || || |||||
Sbjct: 3351573 cttgctatcgtccttgtacacgatcacttcacggttattgaattccacaatggactccag 3351514

                  
Query: 424     atc 426
               |||
Sbjct: 3351513 atc 3351511



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 83       aacttccatggacggggcta 102
                ||||||||||||||||||||
Sbjct: 18082524 aacttccatggacggggcta 18082505

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  281 bits (142), Expect = 9e-73
 Identities = 262/302 (86%)
 Strand = Plus / Minus

                                                                           
Query: 125     tcagcttcagcaaaaccataggagctgaagtgcttcaccttgaacttccactcgccctta 184
               ||||||||| |||| |||||||||||||| ||||| ||| |||| |||||||||||||| 
Sbjct: 3343022 tcagcttcaccaaagccataggagctgaaatgcttgaccctgaatttccactcgcccttg 3342963

                                                                           
Query: 185     gcagcgtcaaacgagatgaactccacaccctgctcctcagccttcttcaccagcatctcc 244
               ||||| || || |||||||||||  |||||||||||||||||||||||||||| ||||||
Sbjct: 3342962 gcagcatcgaatgagatgaactcagcaccctgctcctcagccttcttcaccagtatctcc 3342903

                                                                           
Query: 245     ttgtacttgtccacccttggaccctccgtgtatggctcgcttgtcttcctgttaacacac 304
               ||||||||| ||||||| |||||||| |||||  |||| |  |||||| |||| |  |||
Sbjct: 3342902 ttgtacttgcccaccctcggaccctctgtgtactgctcccccgtcttcttgttcatgcac 3342843

                                                                           
Query: 305     ttgatgttcagaagagtcaccacagcagctttgttcaggccctcgccaaccgggggcttc 364
               ||||| || ||||| |||||||| |||||||| ||||| ||||| ||||| |||||||||
Sbjct: 3342842 ttgatattgagaagggtcaccacggcagctttattcagaccctcaccaacagggggcttc 3342783

                                                                           
Query: 365     tcgttatcatccttgtacacaatcacttcacggttattgaattccacgatcgattccaga 424
               | | |||| ||||||||||| |||||||||||||||||||||||||| || || ||||||
Sbjct: 3342782 ttgctatcgtccttgtacacgatcacttcacggttattgaattccacaatggactccaga 3342723

                 
Query: 425     tc 426
               ||
Sbjct: 3342722 tc 3342721



 Score =  260 bits (131), Expect = 3e-66
 Identities = 260/303 (85%)
 Strand = Plus / Minus

                                                                           
Query: 124     ttcagcttcagcaaaaccataggagctgaagtgcttcaccttgaacttccactcgccctt 183
               |||||||||| |||| |||||||||||||| ||||| ||| |||| ||||||||||| ||
Sbjct: 3351758 ttcagcttcaccaaagccataggagctgaaatgcttgaccctgaatttccactcgccatt 3351699

                                                                           
Query: 184     agcagcgtcaaacgagatgaactccacaccctgctcctcagccttcttcaccagcatctc 243
                 | || || || |||||||||||  |||||||||||||||| |||||||||||||||||
Sbjct: 3351698 gacggcatcgaaagagatgaactcagcaccctgctcctcagctttcttcaccagcatctc 3351639

                                                                           
Query: 244     cttgtacttgtccacccttggaccctccgtgtatggctcgcttgtcttcctgttaacaca 303
               |||||||||||||||||| |||||||| |||||  | || |  |||||| |||| |  ||
Sbjct: 3351638 cttgtacttgtccaccctcggaccctctgtgtactgatcccccgtcttcttgttcatgca 3351579

                                                                           
Query: 304     cttgatgttcagaagagtcaccacagcagctttgttcaggccctcgccaaccgggggctt 363
               |||||| || ||||| |||||||| |||||||| ||||| ||||| ||||| ||||||||
Sbjct: 3351578 cttgatattgagaagggtcaccacggcagctttattcagaccctcaccaacagggggctt 3351519

                                                                           
Query: 364     ctcgttatcatccttgtacacaatcacttcacggttattgaattccacgatcgattccag 423
               || | |||| ||||||||||| |||||||||||||||||||||||||| || || |||||
Sbjct: 3351518 cttgctatcgtccttgtacacgatcacttcacggttattgaattccacaatggactccag 3351459

                  
Query: 424     atc 426
               |||
Sbjct: 3351458 atc 3351456



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 83       aacttccatggacggggcta 102
                ||||||||||||||||||||
Sbjct: 18008845 aacttccatggacggggcta 18008826

>emb|AL844874.1|CNS08CAX Oryza sativa chromosome 12, . BAC OSJNBa0041K23 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 137936

 Score =  281 bits (142), Expect = 9e-73
 Identities = 262/302 (86%)
 Strand = Plus / Minus

                                                                         
Query: 125   tcagcttcagcaaaaccataggagctgaagtgcttcaccttgaacttccactcgccctta 184
             ||||||||| |||| |||||||||||||| ||||| ||| |||| |||||||||||||| 
Sbjct: 22130 tcagcttcaccaaagccataggagctgaaatgcttgaccctgaatttccactcgcccttg 22071

                                                                         
Query: 185   gcagcgtcaaacgagatgaactccacaccctgctcctcagccttcttcaccagcatctcc 244
             ||||| || || |||||||||||  |||||||||||||||||||||||||||| ||||||
Sbjct: 22070 gcagcatcgaatgagatgaactcagcaccctgctcctcagccttcttcaccagtatctcc 22011

                                                                         
Query: 245   ttgtacttgtccacccttggaccctccgtgtatggctcgcttgtcttcctgttaacacac 304
             ||||||||| ||||||| |||||||| |||||  |||| |  |||||| |||| |  |||
Sbjct: 22010 ttgtacttgcccaccctcggaccctctgtgtactgctcccccgtcttcttgttcatgcac 21951

                                                                         
Query: 305   ttgatgttcagaagagtcaccacagcagctttgttcaggccctcgccaaccgggggcttc 364
             ||||| || ||||| |||||||| |||||||| ||||| ||||| ||||| |||||||||
Sbjct: 21950 ttgatattgagaagggtcaccacggcagctttattcagaccctcaccaacagggggcttc 21891

                                                                         
Query: 365   tcgttatcatccttgtacacaatcacttcacggttattgaattccacgatcgattccaga 424
             | | |||| ||||||||||| |||||||||||||||||||||||||| || || ||||||
Sbjct: 21890 ttgctatcgtccttgtacacgatcacttcacggttattgaattccacaatggactccaga 21831

               
Query: 425   tc 426
             ||
Sbjct: 21830 tc 21829



 Score =  260 bits (131), Expect = 3e-66
 Identities = 260/303 (85%)
 Strand = Plus / Minus

                                                                         
Query: 124   ttcagcttcagcaaaaccataggagctgaagtgcttcaccttgaacttccactcgccctt 183
             |||||||||| |||| |||||||||||||| ||||| ||| |||| ||||||||||| ||
Sbjct: 30866 ttcagcttcaccaaagccataggagctgaaatgcttgaccctgaatttccactcgccatt 30807

                                                                         
Query: 184   agcagcgtcaaacgagatgaactccacaccctgctcctcagccttcttcaccagcatctc 243
               | || || || |||||||||||  |||||||||||||||| |||||||||||||||||
Sbjct: 30806 gacggcatcgaaagagatgaactcagcaccctgctcctcagctttcttcaccagcatctc 30747

                                                                         
Query: 244   cttgtacttgtccacccttggaccctccgtgtatggctcgcttgtcttcctgttaacaca 303
             |||||||||||||||||| |||||||| |||||  | || |  |||||| |||| |  ||
Sbjct: 30746 cttgtacttgtccaccctcggaccctctgtgtactgatcccccgtcttcttgttcatgca 30687

                                                                         
Query: 304   cttgatgttcagaagagtcaccacagcagctttgttcaggccctcgccaaccgggggctt 363
             |||||| || ||||| |||||||| |||||||| ||||| ||||| ||||| ||||||||
Sbjct: 30686 cttgatattgagaagggtcaccacggcagctttattcagaccctcaccaacagggggctt 30627

                                                                         
Query: 364   ctcgttatcatccttgtacacaatcacttcacggttattgaattccacgatcgattccag 423
             || | |||| ||||||||||| |||||||||||||||||||||||||| || || |||||
Sbjct: 30626 cttgctatcgtccttgtacacgatcacttcacggttattgaattccacaatggactccag 30567

                
Query: 424   atc 426
             |||
Sbjct: 30566 atc 30564

>gb|BT018715.1| Zea mays clone EL01N0517E03.d mRNA sequence
          Length = 1871

 Score =  149 bits (75), Expect = 9e-33
 Identities = 203/245 (82%), Gaps = 3/245 (1%)
 Strand = Plus / Minus

                                                                        
Query: 143  taggagctgaagtgcttcaccttgaacttccactcgcccttagcagcgtcaaacgagatg 202
            |||| |||||||||||||||| ||||||||||||| |||||  ||||||| || || |  
Sbjct: 1565 taggcgctgaagtgcttcaccctgaacttccactctcccttgacagcgtcgaaggacaca 1506

                                                                        
Query: 203  aactccacaccctgctcctcagccttcttcaccagcatctccttgtacttgtccaccctt 262
            |||||  | ||||||||||| ||||||||||||||||||||| ||||| | ||||| |||
Sbjct: 1505 aactctgcgccctgctcctccgccttcttcaccagcatctccctgtacctctccactctt 1446

                                                                        
Query: 263  ggaccctccgtgtatggctcgcttgtcttcctgttaacacacttgatgttcagaagagtc 322
            |   || ||  | | ||||| |  |||||| |||| || |||||||||||||| ||||||
Sbjct: 1445 g---ccccctggcacggctccccggtcttcttgtttacgcacttgatgttcagtagagtc 1389

                                                                        
Query: 323  accacagcagctttgttcaggccctcgccaaccgggggcttctcgttatcatccttgtac 382
            ||| | ||||| |||||||| |||||||| || |||||||||| | |||| |||||||||
Sbjct: 1388 acctctgcagccttgttcagcccctcgcccacagggggcttcttgctatcgtccttgtac 1329

                 
Query: 383  acaat 387
            |||||
Sbjct: 1328 acaat 1324

>gb|BT018481.1| Zea mays clone EL01N0424C07.d mRNA sequence
          Length = 1900

 Score =  141 bits (71), Expect = 2e-30
 Identities = 233/287 (81%)
 Strand = Plus / Minus

                                                                        
Query: 140  ccataggagctgaagtgcttcaccttgaacttccactcgcccttagcagcgtcaaacgag 199
            ||||||| |||||| ||||||||| ||||||||||||| ||||| ||||| ||||| || 
Sbjct: 1733 ccataggcgctgaaatgcttcaccctgaacttccactctcccttggcagcatcaaaggac 1674

                                                                        
Query: 200  atgaactccacaccctgctcctcagccttcttcaccagcatctccttgtacttgtccacc 259
            |  |||||| | ||||||||||| |||||||||| |||||||||| ||||| | ||||||
Sbjct: 1673 acaaactccgcgccctgctcctccgccttcttcatcagcatctccctgtacctctccacc 1614

                                                                        
Query: 260  cttggaccctccgtgtatggctcgcttgtcttcctgttaacacacttgatgttcagaaga 319
            ||||  |||||   |||   ||| |  |||||| | || || |||||||||||||| |||
Sbjct: 1613 cttgtcccctcacagtactcctccccagtcttcttatttacgcacttgatgttcagtaga 1554

                                                                        
Query: 320  gtcaccacagcagctttgttcaggccctcgccaaccgggggcttctcgttatcatccttg 379
            |||||| | ||||| |||||||| ||||| || || ||||||||||   | || ||||||
Sbjct: 1553 gtcacctccgcagccttgttcagcccctcacccacagggggcttcttcctgtcgtccttg 1494

                                                           
Query: 380  tacacaatcacttcacggttattgaattccacgatcgattccagatc 426
            || |||| ||| || ||||| || || ||||| || |||||||||||
Sbjct: 1493 taaacaaccacctcccggttgttaaactccactattgattccagatc 1447

>gb|AY110896.1| Zea mays CL23032_-2 mRNA sequence
          Length = 625

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 140 ccataggagctgaagtgcttcaccttgaacttccactcgcccttagcagcgtcaaa 195
           ||||||| |||||||||||||||| ||||||||||||| ||||| ||||| |||||
Sbjct: 181 ccataggcgctgaagtgcttcaccctgaacttccactctcccttggcagcatcaaa 236



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 302 cacttgatgttcagaagagtcaccacagcagctttgttcaggccctc 348
           |||||||||||||| ||||||||| | ||||| |||||||| |||||
Sbjct: 343 cacttgatgttcagtagagtcacctccgcagccttgttcagcccctc 389

>gb|AY389582.1| Hyacinthus orientalis nucleoporin mRNA, partial cds
          Length = 732

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 135 caaaaccataggagctgaagtgcttcaccttgaacttccactc 177
           ||||| ||||| ||||||||||||||||| |||||||||||||
Sbjct: 430 caaaatcatagcagctgaagtgcttcaccctgaacttccactc 388

>ref|XM_518147.1| PREDICTED: Pan troglodytes LOC462325 (LOC462325), mRNA
          Length = 17490

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 205  ctccacaccctgctcctcagcct 227
            |||||||||||||||||||||||
Sbjct: 3636 ctccacaccctgctcctcagcct 3614

>gb|AC110034.8| Mus musculus chromosome 3, clone RP23-237L12, complete sequence
          Length = 188908

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 213    cctgctcctcagccttcttcacc 235
              |||||||||||||||||||||||
Sbjct: 134879 cctgctcctcagccttcttcacc 134857

>gb|AC156552.10| Mus musculus chromosome 3, clone RP24-271K21, complete sequence
          Length = 168716

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 213    cctgctcctcagccttcttcacc 235
              |||||||||||||||||||||||
Sbjct: 168214 cctgctcctcagccttcttcacc 168236

>gb|AC149298.1| Populus trichocarpa clone Pop1-021H24, complete sequence
          Length = 146635

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 369   tatcatccttgtacacaatcacttcacggttatt 402
             |||||||| ||||||| || ||||||||||||||
Sbjct: 66442 tatcatccatgtacacgataacttcacggttatt 66409

>gb|AC161470.3| Gallus gallus BAC clone CH261-85J8 from chromosome ul, complete sequence
          Length = 213142

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 207    ccacaccctgctcctcagcct 227
              |||||||||||||||||||||
Sbjct: 104745 ccacaccctgctcctcagcct 104725

>ref|XM_585718.2| PREDICTED: Bos taurus similar to tumor protein p53 inducible protein
            3, transcript variant 1 (LOC508875), mRNA
          Length = 1957

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 229  cttcaccagcatctccttgtactt 252
            |||||||||||||| |||||||||
Sbjct: 1226 cttcaccagcatctgcttgtactt 1203

>gb|AC147329.2| Pan troglodytes BAC clone RP43-21F14 from 7, complete sequence
          Length = 189770

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 129    cttcagcaaaaccataggag 148
              ||||||||||||||||||||
Sbjct: 109436 cttcagcaaaaccataggag 109455

>gb|AC145901.2| Pan troglodytes BAC clone RP43-9F20 from 7, complete sequence
          Length = 176187

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 129  cttcagcaaaaccataggag 148
            ||||||||||||||||||||
Sbjct: 5023 cttcagcaaaaccataggag 5004

>gb|AY494082.1| Homo sapiens cell division cycle 25B (CDC25B) gene, complete cds
          Length = 13771

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 197  gagatgaactccacaccctgctcc 220
            |||||||||||||||| |||||||
Sbjct: 8403 gagatgaactccacactctgctcc 8380

>gb|AC079589.6| Homo sapiens BAC clone RP11-589K23 from 7, complete sequence
          Length = 19706

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 129  cttcagcaaaaccataggag 148
            ||||||||||||||||||||
Sbjct: 1363 cttcagcaaaaccataggag 1344

>emb|AL109804.41|HS1009E24 Human DNA sequence from clone RP5-1009E24 on chromosome 20 Contains the
              5' end of the ADAM33 gene for a disintegrin and
              metalloproteinase domain 33 protein, the SN gene encoding
              sialoadhesin, the C20orf60 gene, the C20orf27 gene, the
              C20orf28 gene, the CENPB gene for centromere protein B, the
              CDC25B gene for cell division cycle protein 25B, the
              C20orf29 gene, the 5' end of the gene for a novel protein
              (KIAA1271) and nine CpG islands, complete sequence
          Length = 185820

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 197    gagatgaactccacaccctgctcc 220
              |||||||||||||||| |||||||
Sbjct: 127277 gagatgaactccacactctgctcc 127254

>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 341     aggccctcgccaaccggggg 360
               ||||||||||||||||||||
Sbjct: 2395864 aggccctcgccaaccggggg 2395883

>gb|AF027333.1|AF027333 Rattus norvegicus thyroid-specific transcription factor 1 gene,
            promoter region and partial cds
          Length = 3056

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  ccctgctcctcagccttctt 231
            ||||||||||||||||||||
Sbjct: 2315 ccctgctcctcagccttctt 2334

>dbj|BA000002.2| Aeropyrum pernix K1 DNA, complete genome
          Length = 1669695

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 209    acaccctgctcctcagccttcttc 232
              ||||||| ||||||||||||||||
Sbjct: 952744 acaccctcctcctcagccttcttc 952721

>emb|BX469886.5| Zebrafish DNA sequence from clone CH211-127D20 in linkage group 19,
             complete sequence
          Length = 151598

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    attattcagaaaacaaaagc 51
             ||||||||||||||||||||
Sbjct: 41342 attattcagaaaacaaaagc 41361

>emb|AL831798.3|CNS08CAB Oryza sativa chromosome 12, . BAC OSJNBb0031E19 of library OSJNBb
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 124294

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   aacttccatggacggggcta 102
            ||||||||||||||||||||
Sbjct: 3168 aacttccatggacggggcta 3187

>emb|AL845343.5|CNS08CB5 Oryza sativa chromosome 12, . BAC OSJNBa0028O09 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 155927

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    aacttccatggacggggcta 102
             ||||||||||||||||||||
Sbjct: 36202 aacttccatggacggggcta 36183

>gb|AC132481.4| Mus musculus BAC clone RP23-14I14 from 17, complete sequence
          Length = 225031

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 250    cttgtccacccttggaccct 269
              ||||||||||||||||||||
Sbjct: 163738 cttgtccacccttggaccct 163719

>gb|AC157784.2| Mus musculus chromosome 18, clone RP24-163C18, complete sequence
          Length = 182283

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   ttcaccagcatctccttgta 249
             ||||||||||||||||||||
Sbjct: 96309 ttcaccagcatctccttgta 96328


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,840,531
Number of Sequences: 3902068
Number of extensions: 3840531
Number of successful extensions: 72626
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72473
Number of HSP's gapped (non-prelim): 145
length of query: 426
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 404
effective length of database: 17,147,199,772
effective search space: 6927468707888
effective search space used: 6927468707888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)