Clone Name | rbastl55f03 |
---|---|
Clone Library Name | barley_pub |
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 155 bits (78), Expect = 1e-34 Identities = 144/166 (86%) Strand = Plus / Minus Query: 163 ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 222 ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| |||||| Sbjct: 19193103 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 19193044 Query: 223 gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 282 |||||||||||||||||||| | |||||||||||| || ||||||||||||||||||||| Sbjct: 19193043 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 19192984 Query: 283 ccgacgtacttgatatcatctatgctgccacgaccgagcgccctca 328 || ||||| ||||| || ||||| |||| ||||| |||||||||| Sbjct: 19192983 ccaacgtatttgatgtcgtctatcgtgccccgaccaagcgccctca 19192938 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 gattattcaccaaatggctg 97 |||||||||||||||||||| Sbjct: 19193185 gattattcaccaaatggctg 19193166
>dbj|AK098921.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N21, full insert sequence Length = 3612 Score = 155 bits (78), Expect = 1e-34 Identities = 144/166 (86%) Strand = Plus / Minus Query: 163 ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 222 ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| |||||| Sbjct: 3333 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 3274 Query: 223 gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 282 |||||||||||||||||||| | |||||||||||| || ||||||||||||||||||||| Sbjct: 3273 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 3214 Query: 283 ccgacgtacttgatatcatctatgctgccacgaccgagcgccctca 328 || ||||| ||||| || ||||| |||| ||||| |||||||||| Sbjct: 3213 ccaacgtatttgatgtcgtctatcgtgccccgaccaagcgccctca 3168 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 gattattcaccaaatggctg 97 |||||||||||||||||||| Sbjct: 3415 gattattcaccaaatggctg 3396
>dbj|AK067777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O03, full insert sequence Length = 3581 Score = 155 bits (78), Expect = 1e-34 Identities = 144/166 (86%) Strand = Plus / Minus Query: 163 ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 222 ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| |||||| Sbjct: 3379 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 3320 Query: 223 gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 282 |||||||||||||||||||| | |||||||||||| || ||||||||||||||||||||| Sbjct: 3319 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 3260 Query: 283 ccgacgtacttgatatcatctatgctgccacgaccgagcgccctca 328 || ||||| ||||| || ||||| |||| ||||| |||||||||| Sbjct: 3259 ccaacgtatttgatgtcgtctatcgtgccccgaccaagcgccctca 3214 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 gattattcaccaaatggctg 97 |||||||||||||||||||| Sbjct: 3461 gattattcaccaaatggctg 3442
>dbj|AK060837.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-C11, full insert sequence Length = 1546 Score = 155 bits (78), Expect = 1e-34 Identities = 144/166 (86%) Strand = Plus / Minus Query: 163 ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 222 ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| |||||| Sbjct: 1314 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 1255 Query: 223 gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 282 |||||||||||||||||||| | |||||||||||| || ||||||||||||||||||||| Sbjct: 1254 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 1195 Query: 283 ccgacgtacttgatatcatctatgctgccacgaccgagcgccctca 328 || ||||| ||||| || ||||| |||| ||||| |||||||||| Sbjct: 1194 ccaacgtatttgatgtcgtctatcgtgccccgaccaagcgccctca 1149 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 gattattcaccaaatggctg 97 |||||||||||||||||||| Sbjct: 1396 gattattcaccaaatggctg 1377
>emb|AL731599.2|OSJN00244 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053B21, complete sequence Length = 151936 Score = 155 bits (78), Expect = 1e-34 Identities = 144/166 (86%) Strand = Plus / Minus Query: 163 ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 222 ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| |||||| Sbjct: 126625 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 126566 Query: 223 gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 282 |||||||||||||||||||| | |||||||||||| || ||||||||||||||||||||| Sbjct: 126565 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 126506 Query: 283 ccgacgtacttgatatcatctatgctgccacgaccgagcgccctca 328 || ||||| ||||| || ||||| |||| ||||| |||||||||| Sbjct: 126505 ccaacgtatttgatgtcgtctatcgtgccccgaccaagcgccctca 126460 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 gattattcaccaaatggctg 97 |||||||||||||||||||| Sbjct: 126707 gattattcaccaaatggctg 126688
>gb|BT019203.1| Zea mays clone Contig876.F mRNA sequence Length = 703 Score = 77.8 bits (39), Expect = 2e-11 Identities = 105/127 (82%) Strand = Plus / Minus Query: 170 ttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcggtttgct 229 ||||||||||| | ||||||||||| ||||||| ||||| | ||| ||||| || |||| Sbjct: 468 ttcagaacgggtagttgatggggtcgcgctgcagggccttttgcaccagctccgtctgct 409 Query: 230 cctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggcccttccgacgt 289 ||||||| || || | |||||| || ||||| || || || || |||||||| ||||||| Sbjct: 408 cctgcacgtgcaccgagtagaagcccgtagcagtagcagccgacggggccctgccgacgt 349 Query: 290 acttgat 296 ||||||| Sbjct: 348 acttgat 342
>gb|BT018365.1| Zea mays clone EL01N0311E09.c mRNA sequence Length = 674 Score = 77.8 bits (39), Expect = 2e-11 Identities = 105/127 (82%) Strand = Plus / Minus Query: 170 ttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcggtttgct 229 ||||||||||| | ||||||||||| ||||||| ||||| | ||| ||||| || |||| Sbjct: 470 ttcagaacgggtagttgatggggtcgcgctgcagggccttttgcaccagctccgtctgct 411 Query: 230 cctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggcccttccgacgt 289 ||||||| || || | |||||| || ||||| || || || || |||||||| ||||||| Sbjct: 410 cctgcacgtgcaccgagtagaagcccgtagcagtagcagccgacggggccctgccgacgt 351 Query: 290 acttgat 296 ||||||| Sbjct: 350 acttgat 344
>gb|AY103815.1| Zea mays PCO096873 mRNA sequence Length = 1431 Score = 69.9 bits (35), Expect = 5e-09 Identities = 104/127 (81%) Strand = Plus / Minus Query: 170 ttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcggtttgct 229 ||||||| ||| | |||| |||||| ||||||||||||||| ||| ||||| || |||| Sbjct: 1130 ttcagaaagggtagttgagggggtcgcgctgcagcgccttctgcaccagctccgtctgct 1071 Query: 230 cctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggcccttccgacgt 289 ||||||| || || | |||||| || || || || || || || |||||||| ||||||| Sbjct: 1070 cctgcacgtgcaccgagtagaagcccgtcgcggtagcagccgacggggccctgccgacgt 1011 Query: 290 acttgat 296 ||||||| Sbjct: 1010 acttgat 1004
>gb|BT013018.1| Lycopersicon esculentum clone 114256R, mRNA sequence Length = 3457 Score = 46.1 bits (23), Expect = 0.070 Identities = 26/27 (96%) Strand = Plus / Minus Query: 246 gtagaaacctgtagctgtggctgcaga 272 ||||||||| ||||||||||||||||| Sbjct: 3141 gtagaaaccagtagctgtggctgcaga 3115
>gb|AY491010.1| Leishmania major Hut1L protein (Hut1L) gene, complete cds Length = 1732 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 taacgcgcgcggtaccacaca 69 ||||||||||||||||||||| Sbjct: 675 taacgcgcgcggtaccacaca 655
>gb|BT018310.1| Zea mays clone EL01T0206H09.c mRNA sequence Length = 817 Score = 40.1 bits (20), Expect = 4.3 Identities = 47/56 (83%) Strand = Plus / Minus Query: 184 ttgatggggtctggctgcagcgccttcttcacgagctcggtttgctcctgcacatg 239 ||||| || |||| |||||| ||||||||||| ||||| | ||||||||| |||| Sbjct: 643 ttgatcggctctgcctgcagtgccttcttcactagctctgactgctcctgcgcatg 588
>gb|AC087289.9| Homo sapiens chromosome 17, clone RP11-552F3, complete sequence Length = 203765 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 260 ctgtggctgcagatggggcc 279 |||||||||||||||||||| Sbjct: 32852 ctgtggctgcagatggggcc 32833
>emb|AL590426.6| Human DNA sequence from clone RP11-354K4 on chromosome 6 Contains novel pseudogene, complete sequence Length = 204235 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 144 tcatggctatgcaaagaacc 163 |||||||||||||||||||| Sbjct: 122766 tcatggctatgcaaagaacc 122747
>emb|AL358216.33| Human DNA sequence from clone RP11-809C18 on chromosome 10 Contains two novel genes, the gene for a novel protein (FLJ38694 FLJ38681) and five CpG islands, complete sequence Length = 96891 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 262 gtggctgcagatggggccct 281 |||||||||||||||||||| Sbjct: 32127 gtggctgcagatggggccct 32146
>emb|AL672262.11| Mouse DNA sequence from clone RP23-318G8 on chromosome 11, complete sequence Length = 101598 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 86 accaaatggctgtaatttag 105 |||||||||||||||||||| Sbjct: 78854 accaaatggctgtaatttag 78835
>emb|CR450779.7| Zebrafish DNA sequence from clone CH211-258C22 in linkage group 5, complete sequence Length = 179980 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 aacaaaattatgcactgaaa 27 |||||||||||||||||||| Sbjct: 125048 aacaaaattatgcactgaaa 125029
>emb|BX322651.3| Zebrafish DNA sequence from clone DKEYP-32G10, complete sequence Length = 152913 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 aacaaaattatgcactgaaa 27 |||||||||||||||||||| Sbjct: 71960 aacaaaattatgcactgaaa 71979
>dbj|AK130224.1| Homo sapiens cDNA FLJ26714 fis, clone PNC01043 Length = 1991 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 gtggctgcagatggggccct 281 |||||||||||||||||||| Sbjct: 910 gtggctgcagatggggccct 891
>gb|AY104202.1| Zea mays PCO125624 mRNA sequence Length = 1720 Score = 40.1 bits (20), Expect = 4.3 Identities = 47/56 (83%) Strand = Plus / Minus Query: 184 ttgatggggtctggctgcagcgccttcttcacgagctcggtttgctcctgcacatg 239 ||||| || |||| |||||| ||||||||||| ||||| | ||||||||| |||| Sbjct: 1545 ttgatcggctctgcctgcagtgccttcttcactagctctgactgctcctgcgcatg 1490 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,642,082 Number of Sequences: 3902068 Number of extensions: 2642082 Number of successful extensions: 45663 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 45624 Number of HSP's gapped (non-prelim): 39 length of query: 328 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 306 effective length of database: 17,147,199,772 effective search space: 5247043130232 effective search space used: 5247043130232 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)