>ref|XM_394814.2| PREDICTED: Apis mellifera similar to ENSANGP00000012437
           (LOC411340), mRNA
          Length = 966

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 209 agaaaaacttgcaatttgagaaact 233
           |||||||||||||||||| ||||||
Sbjct: 930 agaaaaacttgcaatttgtgaaact 954

>gb|AC009410.3| Homo sapiens BAC clone RP11-335M11 from 2, complete sequence
          Length = 189812

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 195    tgtcagattttgtcagaaaaa 215
              |||||||||||||||||||||
Sbjct: 102928 tgtcagattttgtcagaaaaa 102908

>gb|AC170260.2| Mus musculus BAC clone RP24-347N1 from chromosome 5, complete sequence
          Length = 165011

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 34    atcacaagatataaatactatgga 57
             ||||||| ||||||||||||||||
Sbjct: 50142 atcacaacatataaatactatgga 50165

>emb|CT027659.2| Macaca mulatta chromosome 9 BAC CH250-288D8, complete sequence
          Length = 175570

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 190    aagagtgtcagattttgtcagaaa 213
              |||||| |||||||||||||||||
Sbjct: 150443 aagagtctcagattttgtcagaaa 150420

>emb|AL031114.2|HS468H17 Human DNA sequence from clone RP3-468H17 on chromosome Xq21.3-22.1,
             complete sequence
          Length = 115743

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   aattagttgttggatcttaa 126
             ||||||||||||||||||||
Sbjct: 32651 aattagttgttggatcttaa 32632

>emb|BX572606.1| Rhodopseudomonas palustris CGA009 complete genome; segment 14/16
          Length = 349841

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 280   ctgctgaacctgttgcatcg 299
             ||||||||||||||||||||
Sbjct: 60567 ctgctgaacctgttgcatcg 60586

>dbj|AB005228.1| Coturnix coturnix mRNA for TRP-1, complete cds
          Length = 2020

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 276 agctctgctgaacctgttgc 295
           ||||||||||||||||||||
Sbjct: 248 agctctgctgaacctgttgc 267


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,485,148
Number of Sequences: 3902068
Number of extensions: 2485148
Number of successful extensions: 42897
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42888
Number of HSP's gapped (non-prelim): 9
length of query: 313
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 291
effective length of database: 17,147,199,772
effective search space: 4989835133652
effective search space used: 4989835133652
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)