>gb|AC146156.2| Pan troglodytes BAC clone RP43-1P23 from 7, complete sequence
          Length = 172642

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 114   atacctccataaagggaaaaa 134
             |||||||||||||||||||||
Sbjct: 36123 atacctccataaagggaaaaa 36143

>gb|AC145865.2| Pan troglodytes BAC clone RP43-20N5 from 7, complete sequence
          Length = 175581

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 114    atacctccataaagggaaaaa 134
              |||||||||||||||||||||
Sbjct: 101830 atacctccataaagggaaaaa 101810

>gb|AC147039.2| Pan troglodytes BAC clone RP43-117G22 from 7, complete sequence
          Length = 164749

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 114    atacctccataaagggaaaaa 134
              |||||||||||||||||||||
Sbjct: 106455 atacctccataaagggaaaaa 106475

>gb|AC092022.5| Homo sapiens BAC clone RP11-750F10 from 7, complete sequence
          Length = 170141

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 114   atacctccataaagggaaaaa 134
             |||||||||||||||||||||
Sbjct: 62903 atacctccataaagggaaaaa 62883

>emb|AL691468.12| Mouse DNA sequence from clone RP23-20K13 on chromosome 4 Contains the 3'
              end of a novel gene (4933412J03Rik), a
              glyceraldehyde-3-phosphate dehydrogenase (Gapd) pseudogene,
              the Tnfsf15 gene for tumor necrosis factor (ligand)
              superfamily member 15 and the 3' end of the Tnfsf8 for
              tumor necrosis factor (ligand) superfamily member 8,
              complete sequence
          Length = 212420

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 124    aaagggaaaaatgggcatcaa 144
              |||||||||||||||||||||
Sbjct: 210486 aaagggaaaaatgggcatcaa 210466

>emb|AL732599.5| Mouse DNA sequence from clone RP24-312B5 on chromosome 4 Contains
           the 5' end of the Tnfsf8 gene for tumor necrosis factor
           (ligand) superfamily member 8 and a ribosomal protein
           L17 (Rpl17) pseudogene, complete sequence
          Length = 95217

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 124 aaagggaaaaatgggcatcaa 144
           |||||||||||||||||||||
Sbjct: 66  aaagggaaaaatgggcatcaa 46

>gb|AF106564.3| Homo sapiens chromosome 8 clone GS1-72M22 map p21.2, complete sequence
          Length = 143212

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 199   agcccaatgattcttaattt 218
             ||||||||||||||||||||
Sbjct: 36381 agcccaatgattcttaattt 36362

>gb|AC109142.7| Mus musculus chromosome 8, clone RP23-168D5, complete sequence
          Length = 207544

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 202   ccaatgattcttaatttacc 221
             ||||||||||||||||||||
Sbjct: 28562 ccaatgattcttaatttacc 28581

>emb|CR457461.7| Zebrafish DNA sequence from clone DKEY-23O10 in linkage group 14,
             complete sequence
          Length = 213600

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 273   aaccatcatgttttctgcct 292
             ||||||||||||||||||||
Sbjct: 71888 aaccatcatgttttctgcct 71869

>gb|AC021000.9| Homo sapiens chromosome 8, clone RP11-381I2, complete sequence
          Length = 192592

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 199   agcccaatgattcttaattt 218
             ||||||||||||||||||||
Sbjct: 90287 agcccaatgattcttaattt 90268

>ref|XM_690109.1| PREDICTED: Danio rerio similar to Actin-binding LIM protein 3
            (Actin-binding LIM protein family member 3) (abLIM3)
            (LOC566821), mRNA
          Length = 5820

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 273  aaccatcatgttttctgcct 292
            ||||||||||||||||||||
Sbjct: 5595 aaccatcatgttttctgcct 5614

>emb|BX248097.7| Zebrafish DNA sequence from clone CH211-232M8 in linkage group 14,
              complete sequence
          Length = 171333

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 273    aaccatcatgttttctgcct 292
              ||||||||||||||||||||
Sbjct: 139236 aaccatcatgttttctgcct 139217

>emb|BX640457.5| Zebrafish DNA sequence from clone DKEY-17A19 in linkage group 19,
             complete sequence
          Length = 36582

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   ttctctaaccacggcgaccc 187
             ||||||||||||||||||||
Sbjct: 16005 ttctctaaccacggcgaccc 16024

>gb|BC090786.1| Danio rerio cDNA clone IMAGE:7152284
          Length = 1270

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 273  aaccatcatgttttctgcct 292
            ||||||||||||||||||||
Sbjct: 1015 aaccatcatgttttctgcct 1034

>gb|AC145946.3| Gallus gallus BAC clone CH261-23O21 from chromosome unknown, complete
             sequence
          Length = 248690

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   attcttaatttaccaaatca 227
             ||||||||||||||||||||
Sbjct: 41654 attcttaatttaccaaatca 41673

>emb|CT025563.11| Mouse DNA sequence from clone RP23-472D20 on chromosome 14, complete
              sequence
          Length = 174286

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 38     attctgctgatacaaccagt 57
              ||||||||||||||||||||
Sbjct: 125747 attctgctgatacaaccagt 125728

>dbj|AP003108.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-286N22, complete
             sequence
          Length = 209572

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   aaagggaaaaatgggcatca 143
             ||||||||||||||||||||
Sbjct: 15503 aaagggaaaaatgggcatca 15484


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,043,280
Number of Sequences: 3902068
Number of extensions: 3043280
Number of successful extensions: 54027
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54004
Number of HSP's gapped (non-prelim): 23
length of query: 344
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 322
effective length of database: 17,147,199,772
effective search space: 5521398326584
effective search space used: 5521398326584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)