>gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complete sequence
          Length = 114996

 Score =  145 bits (73), Expect = 3e-32
 Identities = 88/93 (94%)
 Strand = Plus / Plus

                                                                       
Query: 4   gccctaaaaatatggatctgtccaaaaatcctacaccgtttgttgatgattgaccaacca 63
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 677 gccctaaaaatatggatctgtccaaaaatcctacaccgtttgttgatgattgaccaaccg 736

                                            
Query: 64  cgaccgtatcaggccgaaatcgatcgatgacgc 96
           |  |||||||||||||| ||| |||||||||||
Sbjct: 737 cagccgtatcaggccgagatcaatcgatgacgc 769

>gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, complete sequence
          Length = 221903

 Score = 42.1 bits (21), Expect = 0.33
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 8      taaaaatatggatctgtccaaaaat 32
              ||||||||| |||||||||||||||
Sbjct: 118754 taaaaatatagatctgtccaaaaat 118778

>gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, complete sequence
          Length = 192682

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 13     atatggatctgtccaaaaatccta 36
              ||||| ||||||||||||||||||
Sbjct: 126616 atatgtatctgtccaaaaatccta 126593

>gb|AY188257.1| Microstrobos fitzgeraldii small ribosomal protein 4 (rps4) gene,
           partial cds; chloroplast gene for chloroplast product
          Length = 617

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 8   taaaaatatggatctgtccaaaaa 31
           ||||||||| ||||||||||||||
Sbjct: 374 taaaaatatagatctgtccaaaaa 397

>gb|AY188256.1| Lepidothamnus intermedius small ribosomal protein 4 (rps4) gene,
           partial cds; chloroplast gene for chloroplast product
          Length = 621

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 8   taaaaatatggatctgtccaaaaa 31
           ||||||||| ||||||||||||||
Sbjct: 375 taaaaatatagatctgtccaaaaa 398

>gb|AY188254.1| Afrocarpus falcatus small ribosomal protein 4 (rps4) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 651

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 8   taaaaatatggatctgtccaaaaa 31
           ||||||||| ||||||||||||||
Sbjct: 387 taaaaatatagatctgtccaaaaa 410

>gb|AF512539.1| Gossypium hirsutum alpha-expansin precursor (Exp1) gene, complete cds
          Length = 1240

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 41   gtttgttgatgattgacca 59
            |||||||||||||||||||
Sbjct: 1193 gtttgttgatgattgacca 1211

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     ttgatgattgaccaaccac 64
              |||||||||||||||||||
Sbjct: 678141 ttgatgattgaccaaccac 678159

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 71      atcaggccgaaatcgatcg 89
               |||||||||||||||||||
Sbjct: 1386826 atcaggccgaaatcgatcg 1386808

>gb|AC146344.1| Mus musculus strain C57BL/6J clone rp23-74a5, complete sequence
          Length = 197449

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aaaatatggatctgtccaa 28
             |||||||||||||||||||
Sbjct: 50714 aaaatatggatctgtccaa 50732

>gb|AY188261.1| Agathis australis small ribosomal protein 4 (rps4) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 624

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 9   aaaaatatggatctgtccaaaaa 31
           |||||||| ||||||||||||||
Sbjct: 379 aaaaatatagatctgtccaaaaa 401

>gb|AY188260.1| Araucaria heterophylla small ribosomal protein 4 (rps4) gene,
           partial cds; chloroplast gene for chloroplast product
          Length = 631

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 9   aaaaatatggatctgtccaaaaa 31
           |||||||| ||||||||||||||
Sbjct: 386 aaaaatatagatctgtccaaaaa 408

>gb|DQ204495.1| Gossypium hirsutum alpha-expansin 1 mRNA, complete cds
          Length = 1114

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 41   gtttgttgatgattgacca 59
            |||||||||||||||||||
Sbjct: 1030 gtttgttgatgattgacca 1048

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 71      atcaggccgaaatcgatcg 89
               |||||||||||||||||||
Sbjct: 4075548 atcaggccgaaatcgatcg 4075566

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 71      atcaggccgaaatcgatcg 89
               |||||||||||||||||||
Sbjct: 3348605 atcaggccgaaatcgatcg 3348587

>gb|AF043284.1|AF043284 Gossypium hirsutum expansin (GhEX1) mRNA, complete cds
          Length = 1102

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 41   gtttgttgatgattgacca 59
            |||||||||||||||||||
Sbjct: 1015 gtttgttgatgattgacca 1033

>emb|AL807786.6| Mouse DNA sequence from clone RP23-320I1 on chromosome 4, complete
             sequence
          Length = 206324

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aaaatatggatctgtccaa 28
             |||||||||||||||||||
Sbjct: 52112 aaaatatggatctgtccaa 52094

>dbj|D88415.1| Cotton mRNA for expansin, clone CF631, partial cds
          Length = 751

 Score = 38.2 bits (19), Expect = 5.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 41  gtttgttgatgattgacca 59
           |||||||||||||||||||
Sbjct: 705 gtttgttgatgattgacca 723


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 644,077
Number of Sequences: 3902068
Number of extensions: 644077
Number of successful extensions: 38658
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38555
Number of HSP's gapped (non-prelim): 103
length of query: 112
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 91
effective length of database: 17,151,101,840
effective search space: 1560750267440
effective search space used: 1560750267440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)