>emb|AL645522.12| Mouse DNA sequence from clone RP23-64E17 on chromosome 11 Cntains the
3' end of the Nipsnap1 gene for 4-nitrophenylphosphatase
domain and non-neuronal SNAP25-like protein homolog 1 (C.
elegans), a novel gene, a ribosomal protein L17 (Rpl17)
pseudogene, the Nefh gene for neurofilament heavy
polypeptide, the Ap1b1 gene for adaptor protein complex
AP-1 beta 1 subunit, the gene for the ortholog of human
RAS-related protein on chromosome 22, the gene for the
ortholog of human growth arrest-specific 2 like 1 GAS2L1
and six CpG islands, complete sequence
Length = 183758
Score = 40.1 bits (20), Expect = 5.1
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 318 ttctacaactgcaaaggaag 337
||||||||||||||||||||
Sbjct: 42628 ttctacaactgcaaaggaag 42609
>emb|BX928740.16| Zebrafish DNA sequence from clone CH211-245J22 in linkage group 18,
complete sequence
Length = 154133
Score = 40.1 bits (20), Expect = 5.1
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 173 aaactgatgtttaaacacat 192
||||||||||||||||||||
Sbjct: 39008 aaactgatgtttaaacacat 38989
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,068,505
Number of Sequences: 3902068
Number of extensions: 4068505
Number of successful extensions: 114999
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 114960
Number of HSP's gapped (non-prelim): 39
length of query: 383
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 361
effective length of database: 17,147,199,772
effective search space: 6190139117692
effective search space used: 6190139117692
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)