ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl55b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK065838.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
2ref|XM_802032.1| Trypanosoma cruzi strain CL Brener mucin-associ... 46 0.081
3ref|XM_816322.1| Trypanosoma cruzi strain CL Brener mucin-associ... 46 0.081
4ref|XM_816628.1| Trypanosoma cruzi strain CL Brener mucin-associ... 46 0.081
5ref|XM_815319.1| Trypanosoma cruzi strain CL Brener mucin-associ... 46 0.081
6ref|XM_806270.1| Trypanosoma cruzi strain CL Brener mucin-associ... 46 0.081
7ref|XM_808166.1| Trypanosoma cruzi strain CL Brener mucin-associ... 44 0.32
8gb|AC110025.4| Homo sapiens chromosome 8, clone CTD-2294G15, com... 44 0.32
9dbj|AK121495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.32
10dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.3
11gb|AC079227.12| Homo sapiens BAC clone RP11-80B23 from 4, comple... 42 1.3
12gb|AC092618.2| Homo sapiens BAC clone RP11-221D24 from 2, comple... 42 1.3
13gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.3
14emb|AL731748.3|CNS08C7X Oryza sativa chromosome 12, . BAC OSJNBa... 42 1.3
15emb|AL935188.7| Zebrafish DNA sequence from clone CH211-243G6, c... 42 1.3
16ref|XM_630526.1| Dictyostelium discoideum hypothetical protein (... 40 5.0
17emb|CR936839.12| Mouse DNA sequence from clone CH29-120A16 on ch... 40 5.0
18gb|AY368652.1| Homo sapiens multiple myeloma susceptibility tumo... 40 5.0
19emb|AL590482.11| Human DNA sequence from clone RP11-142J11 on ch... 40 5.0
20emb|AL139085.13| Human DNA sequence from clone RP11-431O22 on ch... 40 5.0
21emb|AL645744.16| Mouse DNA sequence from clone RP23-148E7 on chr... 40 5.0
22emb|AL645951.20| Mouse DNA sequence from clone DN-29B18 on chrom... 40 5.0
23gb|DQ354447.1| Isoodon obesulus breast and ovarian cancer suscep... 40 5.0
24gb|AC022306.6| Homo sapiens chromosome 15 clone RP11-295H24 map ... 40 5.0
25gb|AC152825.4| Mus musculus BAC clone RP24-135P4 from chromosome... 40 5.0
26emb|BX649312.6| Zebrafish DNA sequence from clone DKEY-170M15 in... 40 5.0
27emb|AL713964.8| Mouse DNA sequence from clone DN-28A3 on chromos... 40 5.0

>dbj|AK065838.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039J03, full
            insert sequence
          Length = 3101

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                        
Query: 297  cattcttcagaaattactttcgccaccaaatgtagatgggggatggactgcgtcatatgc 356
            ||||||||||||||| ||| | ||||||||||| |  || |||||  ||||| |||| ||
Sbjct: 2866 cattcttcagaaatttcttccaccaccaaatgttggaggaggatgagctgcgccataggc 2807

                              
Query: 357  tggaaattcctgtggtgc 374
            || | |||||||||||||
Sbjct: 2806 tgaatattcctgtggtgc 2789



to top

>ref|XM_802032.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053510085.60) partial mRNA
          Length = 1098

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  tgcaggtacaaataacagcaccg 121
           |||||||||||||||||||||||
Sbjct: 503 tgcaggtacaaataacagcaccg 525



to top

>ref|XM_816322.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053504081.400) partial mRNA
          Length = 1092

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  tgcaggtacaaataacagcaccg 121
           |||||||||||||||||||||||
Sbjct: 497 tgcaggtacaaataacagcaccg 519



to top

>ref|XM_816628.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053508873.580) partial mRNA
          Length = 1098

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  tgcaggtacaaataacagcaccg 121
           |||||||||||||||||||||||
Sbjct: 500 tgcaggtacaaataacagcaccg 522



to top

>ref|XM_815319.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053503973.190) partial mRNA
          Length = 1089

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  tgcaggtacaaataacagcaccg 121
           |||||||||||||||||||||||
Sbjct: 497 tgcaggtacaaataacagcaccg 519



to top

>ref|XM_806270.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053508125.14) partial mRNA
          Length = 685

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 99  tgcaggtacaaataacagcaccg 121
           |||||||||||||||||||||||
Sbjct: 509 tgcaggtacaaataacagcaccg 531



to top

>ref|XM_808166.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053510237.120) partial mRNA
          Length = 1095

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 100 gcaggtacaaataacagcaccg 121
           ||||||||||||||||||||||
Sbjct: 501 gcaggtacaaataacagcaccg 522



to top

>gb|AC110025.4| Homo sapiens chromosome 8, clone CTD-2294G15, complete sequence
          Length = 108074

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 290   atattagcattcttcagaaattactt 315
             ||||| ||||||||||||||||||||
Sbjct: 36827 atatttgcattcttcagaaattactt 36802



to top

>dbj|AK121495.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033001A07, full
            insert sequence
          Length = 3089

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                        
Query: 297  cattcttcagaaattactttcgccaccaaatgtagatgggggatggactgcgtcatatgc 356
            ||||||||| ||||| ||| | ||||||||||| |  || |||||  ||||| |||| ||
Sbjct: 2866 cattcttcaaaaatttcttccaccaccaaatgttggaggaggatgagctgcgccataggc 2807

                              
Query: 357  tggaaattcctgtggtgc 374
            || | |||||||||||||
Sbjct: 2806 tgaatattcctgtggtgc 2789



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                
Query: 297     cattcttcagaaattactttcgccaccaaatgt 329
               ||||||||||||||| ||| | |||||||||||
Sbjct: 3062520 cattcttcagaaatttcttccaccaccaaatgt 3062488



to top

>gb|AC079227.12| Homo sapiens BAC clone RP11-80B23 from 4, complete sequence
          Length = 181942

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 75     tgttctttgaatgactatttt 95
              |||||||||||||||||||||
Sbjct: 155559 tgttctttgaatgactatttt 155539



to top

>gb|AC092618.2| Homo sapiens BAC clone RP11-221D24 from 2, complete sequence
          Length = 98060

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 263   aatcagttaatgaaatatgaa 283
             |||||||||||||||||||||
Sbjct: 86297 aatcagttaatgaaatatgaa 86277



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                
Query: 297     cattcttcagaaattactttcgccaccaaatgt 329
               ||||||||||||||| ||| | |||||||||||
Sbjct: 3062465 cattcttcagaaatttcttccaccaccaaatgt 3062433



to top

>emb|AL731748.3|CNS08C7X Oryza sativa chromosome 12, . BAC OSJNBa0095K18 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 159711

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 297   cattcttcagaaattactttcgccaccaaatgt 329
             ||||||||||||||| ||| | |||||||||||
Sbjct: 92323 cattcttcagaaatttcttccaccaccaaatgt 92355



to top

>emb|AL935188.7| Zebrafish DNA sequence from clone CH211-243G6, complete sequence
          Length = 160946

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 271   aatgaaatatgaacttctgat 291
             |||||||||||||||||||||
Sbjct: 62755 aatgaaatatgaacttctgat 62775



to top

>ref|XM_630526.1| Dictyostelium discoideum hypothetical protein (DDB0188922), partial
            mRNA
          Length = 2235

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 258  acaacaatcagttaatgaaa 277
            ||||||||||||||||||||
Sbjct: 1554 acaacaatcagttaatgaaa 1573



to top

>emb|CR936839.12| Mouse DNA sequence from clone CH29-120A16 on chromosome 1, complete
              sequence
          Length = 250586

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    gcagtttaggattcaacaca 247
              ||||||||||||||||||||
Sbjct: 102841 gcagtttaggattcaacaca 102860



to top

>gb|AY368652.1| Homo sapiens multiple myeloma susceptibility tumor suppressor
           protein mRNA, complete cds
          Length = 1491

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 255 catacaacaatcagttaatg 274
           ||||||||||||||||||||
Sbjct: 991 catacaacaatcagttaatg 972



to top

>emb|AL590482.11| Human DNA sequence from clone RP11-142J11 on chromosome 6 Contains the
             3' end of a gene for a novel protein, complete sequence
          Length = 97255

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 60    atggtttcttctccatgttc 79
             ||||||||||||||||||||
Sbjct: 74571 atggtttcttctccatgttc 74590



to top

>emb|AL139085.13| Human DNA sequence from clone RP11-431O22 on chromosome 13 Contains the
             5' end of the gene for chondromodulin I precursor (CHM-I),
             a novel gene, the PCDH8 gene for protocadherin 8 and 4 CpG
             islands, complete sequence
          Length = 173292

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 255   catacaacaatcagttaatg 274
             ||||||||||||||||||||
Sbjct: 22030 catacaacaatcagttaatg 22049



to top

>emb|AL645744.16| Mouse DNA sequence from clone RP23-148E7 on chromosome 1 Contains the
             Icos gene for inducible T-cell co-stimulator, complete
             sequence
          Length = 108015

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   gcagtttaggattcaacaca 247
             ||||||||||||||||||||
Sbjct: 51853 gcagtttaggattcaacaca 51834



to top

>emb|AL645951.20| Mouse DNA sequence from clone DN-29B18 on chromosome 1 Contains a
            ribosomal protein L17 (RPL17) pseudogene and a tigger
            transposable element derived 1 (TIGD1) pseudogene,
            complete sequence
          Length = 129519

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  gcagtttaggattcaacaca 247
            ||||||||||||||||||||
Sbjct: 4975 gcagtttaggattcaacaca 4956



to top

>gb|DQ354447.1| Isoodon obesulus breast and ovarian cancer susceptibility 1 (BRCA1)
            gene, partial cds
          Length = 2444

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 356  ctggaaattcctgtggtgct 375
            ||||||||||||||||||||
Sbjct: 1996 ctggaaattcctgtggtgct 1977



to top

>gb|AC022306.6| Homo sapiens chromosome 15 clone RP11-295H24 map 15q21.1, complete
             sequence
          Length = 176827

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 281   gaacttctgatattagcattcttcagaa 308
             ||||||||| ||||| ||||||||||||
Sbjct: 44743 gaacttctgttattaacattcttcagaa 44770



to top

>gb|AC152825.4| Mus musculus BAC clone RP24-135P4 from chromosome 9, complete sequence
          Length = 140471

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 285   ttctgatattagcattcttc 304
             ||||||||||||||||||||
Sbjct: 69180 ttctgatattagcattcttc 69161



to top

>emb|BX649312.6| Zebrafish DNA sequence from clone DKEY-170M15 in linkage group 20,
              complete sequence
          Length = 162661

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     ctccatgttctttgaatgac 89
              ||||||||||||||||||||
Sbjct: 151593 ctccatgttctttgaatgac 151574



to top

>emb|AL713964.8| Mouse DNA sequence from clone DN-28A3 on chromosome 1, complete
            sequence
          Length = 10721

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 228  gcagtttaggattcaacaca 247
            ||||||||||||||||||||
Sbjct: 5747 gcagtttaggattcaacaca 5766


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,039,378
Number of Sequences: 3902068
Number of extensions: 4039378
Number of successful extensions: 72274
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72169
Number of HSP's gapped (non-prelim): 105
length of query: 376
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 354
effective length of database: 17,147,199,772
effective search space: 6070108719288
effective search space used: 6070108719288
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top