ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl55a09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|BX538053.1|HSM806224 Homo sapiens genomic DNA; cDNA DKFZp686... 40 1.6
2gb|AC107628.4| Homo sapiens chromosome 8, clone CTD1-2009P10, co... 40 1.6
3gb|AY048575.1| Xenopus laevis Pax6 gene, promoter and 5'UTR 40 1.6
4gb|AC163744.3| Pan troglodytes BAC clone CH251-376E11 from chrom... 40 1.6
5gb|AC175061.3| Pan troglodytes BAC clone CH251-572M8 from chromo... 40 1.6
6emb|BX470100.6| Zebrafish DNA sequence from clone DKEY-239K7 in ... 40 1.6
7dbj|AP005367.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 1.6
8dbj|AP004295.1| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 1.6
9gb|AC109279.13| Mus musculus chromosome 1, clone RP23-333O12, co... 38 6.5
10ref|NM_178753.2| Mus musculus RIKEN cDNA 9630042H07 gene (963004... 38 6.5
11gb|AC122508.3| Mus musculus BAC clone RP24-427G15 from chromosom... 38 6.5
12ref|XM_711371.1| Candida albicans SC5314 hypothetical protein (C... 38 6.5
13gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 38 6.5
14ref|XM_455439.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F07931g ... 38 6.5
15gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESR... 38 6.5
16gb|AC122882.4| Mus musculus BAC clone RP23-80M17 from chromosome... 38 6.5
17emb|CT025636.2| Pan troglodytes chromosome X clone RP43-029M22 m... 38 6.5
18emb|CR847808.6| Zebrafish DNA sequence from clone CH211-151I8 in... 38 6.5
19gb|AY120853.2| Synechococcus sp. PCC 7942 processing protease-li... 38 6.5
20emb|AL603752.6| Human DNA sequence from clone RP11-296A1 on chro... 38 6.5
21emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 38 6.5
22emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete g... 38 6.5
23emb|AL929071.6| Mouse DNA sequence from clone RP24-450M24 on chr... 38 6.5
24gb|AC104967.4| Homo sapiens chromosome 8, clone CTD-2306F16, com... 38 6.5
25dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 38 6.5
26dbj|AK147852.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 38 6.5
27gb|AC008942.6| Homo sapiens chromosome 5 clone CTD-2320O4, compl... 38 6.5
28gb|AC025472.4| Homo sapiens chromosome 5 clone RP11-15G6, comple... 38 6.5
29dbj|AK036158.1| Mus musculus 16 days neonate cerebellum cDNA, RI... 38 6.5
30gb|AC034231.6|AC034231 Homo sapiens chromosome 5 clone CTD-2203K... 38 6.5
31dbj|AK047896.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 38 6.5
32dbj|AK033181.1| Mus musculus 15 days embryo male testis cDNA, RI... 38 6.5
33gb|AC074270.25|AC074270 Homo sapiens 12 BAC RP11-84G21 (Roswell ... 38 6.5
34gb|AC171141.2| Helobdella robusta clone CH306-1B3, complete sequ... 38 6.5
35emb|BX470092.12| Mouse DNA sequence from clone RP23-230K20 on ch... 38 6.5
36gb|AC006445.11|AC006445 Homo sapiens chromosome 4 clone C0367I21... 38 6.5
37gb|BC027796.1| Mus musculus RIKEN cDNA 9630042H07 gene, mRNA (cD... 38 6.5
38emb|BX321898.29| Zebrafish DNA sequence from clone DKEYP-34C12 i... 38 6.5
39gb|U73479.1|U73479 Homo sapiens cosmid clone U138C3 from Xp22.1-... 38 6.5
40gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 38 6.5 
>emb|BX538053.1|HSM806224 Homo sapiens genomic DNA; cDNA DKFZp686L04145 (from clone
            DKFZp686L04145)
          Length = 3770

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 19   cattgattgcaaaaataaat 38
            ||||||||||||||||||||
Sbjct: 2887 cattgattgcaaaaataaat 2906
to top
>gb|AC107628.4| Homo sapiens chromosome 8, clone CTD1-2009P10, complete sequence
          Length = 102718

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    cattgattgcaaaaataaat 38
             ||||||||||||||||||||
Sbjct: 43071 cattgattgcaaaaataaat 43090
to top
>gb|AY048575.1| Xenopus laevis Pax6 gene, promoter and 5'UTR
          Length = 2603

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 20   attgattgcaaaaataaatt 39
            ||||||||||||||||||||
Sbjct: 1488 attgattgcaaaaataaatt 1507
to top
>gb|AC163744.3| Pan troglodytes BAC clone CH251-376E11 from chromosome unknown, complete
              sequence
          Length = 195342

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     cattgattgcaaaaataaat 38
              ||||||||||||||||||||
Sbjct: 160142 cattgattgcaaaaataaat 160161
to top
>gb|AC175061.3| Pan troglodytes BAC clone CH251-572M8 from chromosome unknown, complete
             sequence
          Length = 191409

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    cattgattgcaaaaataaat 38
             ||||||||||||||||||||
Sbjct: 46979 cattgattgcaaaaataaat 46960
to top
>emb|BX470100.6| Zebrafish DNA sequence from clone DKEY-239K7 in linkage group 18,
             complete sequence
          Length = 117304

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 61    cagacattatttggcagatagctt 84
             |||||||||||||||| |||||||
Sbjct: 61196 cagacattatttggcatatagctt 61173
to top
>dbj|AP005367.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB800C8, complete
              sequence
          Length = 112111

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     cattgattgcaaaaataaat 38
              ||||||||||||||||||||
Sbjct: 104560 cattgattgcaaaaataaat 104541
to top
>dbj|AP004295.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1907E5
          Length = 154597

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    cattgattgcaaaaataaat 38
             ||||||||||||||||||||
Sbjct: 21892 cattgattgcaaaaataaat 21873
to top
>gb|AC109279.13| Mus musculus chromosome 1, clone RP23-333O12, complete sequence
          Length = 199028

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 20     attgattgcaaaaataaat 38
              |||||||||||||||||||
Sbjct: 130820 attgattgcaaaaataaat 130838
to top
>ref|NM_178753.2| Mus musculus RIKEN cDNA 9630042H07 gene (9630042H07Rik), mRNA
          Length = 4182

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 26   tgcaaaaataaattccagttgat 48
            ||||||||||||||||| |||||
Sbjct: 2794 tgcaaaaataaattccatttgat 2772
to top
>gb|AC122508.3| Mus musculus BAC clone RP24-427G15 from chromosome 12, complete
             sequence
          Length = 169567

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    ttgattgcaaaaataaatt 39
             |||||||||||||||||||
Sbjct: 56307 ttgattgcaaaaataaatt 56325
to top
>ref|XM_711371.1| Candida albicans SC5314 hypothetical protein (CaO19_7330), mRNA
          Length = 714

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 20 attgattgcaaaaataaat 38
          |||||||||||||||||||
Sbjct: 62 attgattgcaaaaataaat 44
to top
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 14      ccggccattgattgcaaaa 32
               |||||||||||||||||||
Sbjct: 1582571 ccggccattgattgcaaaa 1582589
to top
>ref|XM_455439.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F07931g predicted mRNA
          Length = 1473

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 35   aaattccagttgatccaca 53
            |||||||||||||||||||
Sbjct: 1362 aaattccagttgatccaca 1344
to top
>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds
          Length = 590284

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     aaaaataaattccagttga 47
              |||||||||||||||||||
Sbjct: 234679 aaaaataaattccagttga 234661
to top
>gb|AC122882.4| Mus musculus BAC clone RP23-80M17 from chromosome 7, complete sequence
          Length = 260989

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     ttgattgcaaaaataaatt 39
              |||||||||||||||||||
Sbjct: 134909 ttgattgcaaaaataaatt 134891
to top
>emb|CT025636.2| Pan troglodytes chromosome X clone RP43-029M22 map Xq28, complete
             sequence
          Length = 176404

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    aaaaataaattccagttga 47
             |||||||||||||||||||
Sbjct: 61973 aaaaataaattccagttga 61991
to top
>emb|CR847808.6| Zebrafish DNA sequence from clone CH211-151I8 in linkage group 22,
             complete sequence
          Length = 147994

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 61    cagacattatttggcagatagctttca 87
             ||||||||||||| |||| ||||||||
Sbjct: 65270 cagacattatttgacagaaagctttca 65244
to top
>gb|AY120853.2| Synechococcus sp. PCC 7942 processing protease-like protein gene,
             partial cds; phycocyanobilin:ferredoxin
             oxidoreductase-like protein, DevB (devB), DevC (devC),
             tRNA pseudoridine 55 synthase, CheY (cheY), 50S ribosomal
             protein L27, 50S ribosomal protein L21, KaiA (kaiA), KaiB
             (kaiB), KaiC (kaiC), glutathione peroxidase, virulence
             associated protein C, rRNA methylase-like protein, PhdD
             (phdD), indole-3-glycerol phosphate synthase-like protein,
             PdxJ (pdxJ), KguA (kguA), AmpA (ampA), MobA (mobA),
             transferrin variant A-like protein,
             6-pyruvoyl-tetrahydropterin synthase-like protein, NugC
             (nugC), NdhK (ndhK), Nu3C (nu3C), RubR (rubR), PsbE
             (psbE), PsbF (psbF), PsbL (psbL), PsbJ (psbJ),
             apolipoprotein N-acyltransferase-like protein, unknown
             protein, IspF (ispF), Ap-4-A phosphorylase II-like
             protein, PanC (panC), Kcy (kcy), and dTDP-glucose
             4-6-dehydratase-like protein genes, complete cds; and
             unknown genes
          Length = 74355

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 73    ggcagatagctttcaaacg 91
             |||||||||||||||||||
Sbjct: 41800 ggcagatagctttcaaacg 41818
to top
>emb|AL603752.6| Human DNA sequence from clone RP11-296A1 on chromosome 1 Contains part
             of the ESRRG gene for  estrogen-related receptor gamma,
             complete sequence
          Length = 48868

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    aaaaataaattccagttga 47
             |||||||||||||||||||
Sbjct: 38671 aaaaataaattccagttga 38689
to top
>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2602197

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 35     aaattccagttgatccaca 53
              |||||||||||||||||||
Sbjct: 745518 aaattccagttgatccaca 745500
to top
>emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete genome
          Length = 2414465

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 46      gatccacagcaacgccaga 64
               |||||||||||||||||||
Sbjct: 1659538 gatccacagcaacgccaga 1659556
to top
>emb|AL929071.6| Mouse DNA sequence from clone RP24-450M24 on chromosome 11 Contains the
              gene for a novel solute carrier family 13 (sodium-dependent
              dicarboxylate transporter) (Slc13a2 or 3) member, a novel
              gene, the gene for a novel TRAF-type zinc finger protein,
              the gene for a novel F-box domain containing protein, the
              Tekt1 gene for tektin 1 and a CpG island, complete sequence
          Length = 154561

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 92     ttcatgtttgattctagac 110
              |||||||||||||||||||
Sbjct: 114240 ttcatgtttgattctagac 114222
to top
>gb|AC104967.4| Homo sapiens chromosome 8, clone CTD-2306F16, complete sequence
          Length = 144098

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 24     attgcaaaaataaattccagttg 46
              ||||||| |||||||||||||||
Sbjct: 101470 attgcaagaataaattccagttg 101492
to top
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 73     ggcagatagctttcaaacg 91
              |||||||||||||||||||
Sbjct: 414923 ggcagatagctttcaaacg 414941
to top
>dbj|AK147852.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
            clone:G270069D24 product:Similar to spindlin (Ovarian
            cancer-related protein), full insert sequence
          Length = 3851

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 26   tgcaaaaataaattccagttgat 48
            ||||||||||||||||| |||||
Sbjct: 2753 tgcaaaaataaattccatttgat 2731
to top
>gb|AC008942.6| Homo sapiens chromosome 5 clone CTD-2320O4, complete sequence
          Length = 148917

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 19     cattgattgcaaaaataaa 37
              |||||||||||||||||||
Sbjct: 101167 cattgattgcaaaaataaa 101185
to top
>gb|AC025472.4| Homo sapiens chromosome 5 clone RP11-15G6, complete sequence
          Length = 171744

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     acattatttggcagatagc 82
              |||||||||||||||||||
Sbjct: 168331 acattatttggcagatagc 168313
to top
>dbj|AK036158.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:9630042H07 product:similar to
            SPINDLIN [Gallus gallus], full insert sequence
          Length = 4182

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 26   tgcaaaaataaattccagttgat 48
            ||||||||||||||||| |||||
Sbjct: 2794 tgcaaaaataaattccatttgat 2772
to top
>gb|AC034231.6|AC034231 Homo sapiens chromosome 5 clone CTD-2203K17, complete sequence
          Length = 34136

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 64   acattatttggcagatagc 82
            |||||||||||||||||||
Sbjct: 1363 acattatttggcagatagc 1345
to top
>dbj|AK047896.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130020H17 product:similar to SPINDLIN
            [Gallus gallus], full insert sequence
          Length = 3885

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 26   tgcaaaaataaattccagttgat 48
            ||||||||||||||||| |||||
Sbjct: 2748 tgcaaaaataaattccatttgat 2726
to top
>dbj|AK033181.1| Mus musculus 15 days embryo male testis cDNA, RIKEN full-length
            enriched library, clone:8030454E18
            product:unclassifiable, full insert sequence
          Length = 3199

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 26   tgcaaaaataaattccagttgat 48
            ||||||||||||||||| |||||
Sbjct: 2103 tgcaaaaataaattccatttgat 2081
to top
>gb|AC074270.25|AC074270 Homo sapiens 12 BAC RP11-84G21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 140597

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 28    caaaaataaattccagttg 46
             |||||||||||||||||||
Sbjct: 99355 caaaaataaattccagttg 99373
to top
>gb|AC171141.2| Helobdella robusta clone CH306-1B3, complete sequence
          Length = 94001

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ttgattgcaaaaataaatt 39
             |||||||||||||||||||
Sbjct: 78551 ttgattgcaaaaataaatt 78533
to top
>emb|BX470092.12| Mouse DNA sequence from clone RP23-230K20 on chromosome X, complete
             sequence
          Length = 95593

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 26    tgcaaaaataaattccagttgat 48
             ||||||||||||||||| |||||
Sbjct: 55908 tgcaaaaataaattccatttgat 55930
to top
>gb|AC006445.11|AC006445 Homo sapiens chromosome 4 clone C0367I21, complete sequence
          Length = 174547

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     aaaaataaattccagttga 47
              |||||||||||||||||||
Sbjct: 162509 aaaaataaattccagttga 162491
to top
>gb|BC027796.1| Mus musculus RIKEN cDNA 9630042H07 gene, mRNA (cDNA clone MGC:38206
            IMAGE:5323183), complete cds
          Length = 3912

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 26   tgcaaaaataaattccagttgat 48
            ||||||||||||||||| |||||
Sbjct: 2753 tgcaaaaataaattccatttgat 2731
to top
>emb|BX321898.29| Zebrafish DNA sequence from clone DKEYP-34C12 in linkage group 22,
              complete sequence
          Length = 195042

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 61     cagacattatttggcagatagctttca 87
              ||||||||||||| |||| ||||||||
Sbjct: 130992 cagacattatttgacagaaagctttca 131018
to top
>gb|U73479.1|U73479 Homo sapiens cosmid clone U138C3 from Xp22.1-22.2, complete sequence
          Length = 36029

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    aaaaataaattccagttga 47
             |||||||||||||||||||
Sbjct: 18177 aaaaataaattccagttga 18195
to top
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 73      ggcagatagctttcaaacg 91
               |||||||||||||||||||
Sbjct: 1205882 ggcagatagctttcaaacg 1205864


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,380,338
Number of Sequences: 3902068
Number of extensions: 1380338
Number of successful extensions: 91019
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 90866
Number of HSP's gapped (non-prelim): 153
length of query: 137
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 116
effective length of database: 17,151,101,840
effective search space: 1989527813440
effective search space used: 1989527813440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top