>gb|AC121334.5| Homo sapiens 12 BAC RP11-242C24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 185847

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 248    taatttacacatggaaatggaattta 273
              ||||||||| ||||||||||||||||
Sbjct: 164734 taatttacaaatggaaatggaattta 164759

>gb|AC004553.1| Homo sapiens X GSHB-223P11 (Genome Systems Human BAC library) complete
             sequence
          Length = 80659

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 251   tttacacatggaaatggaattt 272
             ||||||||||||||||||||||
Sbjct: 23731 tttacacatggaaatggaattt 23710

>emb|CR378663.1| Photobacterium profundum SS9; segment 1/12
          Length = 348044

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 211    tgacaagaacaccctcaacaagcaa 235
              ||||||| |||||||||||||||||
Sbjct: 236950 tgacaagcacaccctcaacaagcaa 236974

>ref|NM_125258.3| Arabidopsis thaliana ROC7; peptidyl-prolyl cis-trans isomerase
           AT5G58710 (ROC7) mRNA, complete cds
          Length = 917

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 tttacacatggaaatggaat 270
           ||||||||||||||||||||
Sbjct: 361 tttacacatggaaatggaat 380

>gb|AY165702.1| Bombus sp. SLB-2003 cytochrome c oxidase subunit I (COI) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 624

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 105 taataatactgtaatacata 124
           ||||||||||||||||||||
Sbjct: 516 taataatactgtaatacata 497

>gb|AC131912.6| Mus musculus chromosome 9, clone RP24-164A20, complete sequence
          Length = 204724

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 245   gcttaatttacacatggaaatgga 268
             |||||||||||||||||| |||||
Sbjct: 55890 gcttaatttacacatggagatgga 55913

>gb|AC125188.4| Mus musculus BAC clone RP23-303O19 from chromosome 9, complete sequence
          Length = 194053

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 333    attatggcatcccttctcct 352
              ||||||||||||||||||||
Sbjct: 181806 attatggcatcccttctcct 181787

>gb|AC087184.7| Mus Musculus Chromosome 3 RP23-403C5, complete sequence
          Length = 206400

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 40     agagcaaatgccagttcata 59
              ||||||||||||||||||||
Sbjct: 124110 agagcaaatgccagttcata 124091

>gb|AY094017.1| Arabidopsis thaliana AT5g58710/mzn1_160 mRNA, complete cds
          Length = 615

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 tttacacatggaaatggaat 270
           ||||||||||||||||||||
Sbjct: 313 tttacacatggaaatggaat 332

>gb|AY048227.1| Arabidopsis thaliana AT5g58710/mzn1_160 mRNA, complete cds
          Length = 832

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 tttacacatggaaatggaat 270
           ||||||||||||||||||||
Sbjct: 327 tttacacatggaaatggaat 346

>gb|AC016749.4|AC016749 Homo sapiens clone RP11-504E20, complete sequence
          Length = 187117

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   taataatactgtaatacata 124
             ||||||||||||||||||||
Sbjct: 40733 taataatactgtaatacata 40752

>emb|BX832221.1|CNS09ZS2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH5ZA06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 tttacacatggaaatggaat 270
           ||||||||||||||||||||
Sbjct: 358 tttacacatggaaatggaat 377

>emb|BX830463.1|CNS09ZYM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB83ZF05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 839

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 tttacacatggaaatggaat 270
           ||||||||||||||||||||
Sbjct: 339 tttacacatggaaatggaat 358

>gb|AC007041.3| Homo sapiens BAC clone RP11-327N17 from 2, complete sequence
          Length = 173397

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 9     tagcacgctgctaataaattagccacat 36
             |||||||||||||||||| || ||||||
Sbjct: 48543 tagcacgctgctaataaaatatccacat 48570

>gb|AC073987.4| Homo sapiens BAC clone RP11-441C24 from 2, complete sequence
          Length = 152351

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 31     ccacatccaagagcaaatgccagt 54
              ||||||| ||||||||||||||||
Sbjct: 122990 ccacatcgaagagcaaatgccagt 123013

>gb|AY086471.1| Arabidopsis thaliana clone 25325 mRNA, complete sequence
          Length = 780

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 tttacacatggaaatggaat 270
           ||||||||||||||||||||
Sbjct: 356 tttacacatggaaatggaat 375

>dbj|AB020755.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MZN1
          Length = 81672

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   tttacacatggaaatggaat 270
             ||||||||||||||||||||
Sbjct: 53532 tttacacatggaaatggaat 53551

>gb|AF192490.1|AF192490 Arabidopsis thaliana cyclophilin (ROC7) mRNA, complete cds
          Length = 761

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 tttacacatggaaatggaat 270
           ||||||||||||||||||||
Sbjct: 336 tttacacatggaaatggaat 355

>gb|AC147636.3| Mus musculus BAC clone RP23-201C3 from 9, complete sequence
          Length = 202197

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 333    attatggcatcccttctcct 352
              ||||||||||||||||||||
Sbjct: 161331 attatggcatcccttctcct 161350

>emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chromosome 9, complete
              sequence
          Length = 168760

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 245    gcttaatttacacatggaaatgga 268
              |||||||||||||||||| |||||
Sbjct: 120789 gcttaatttacacatggagatgga 120812

>gb|AF084916.1|AF084916 Bombus ternarius cytochrome oxidase I gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 333

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 105 taataatactgtaatacata 124
           ||||||||||||||||||||
Sbjct: 81  taataatactgtaatacata 62


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,430,821
Number of Sequences: 3902068
Number of extensions: 3430821
Number of successful extensions: 64230
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64199
Number of HSP's gapped (non-prelim): 31
length of query: 378
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 356
effective length of database: 17,147,199,772
effective search space: 6104403118832
effective search space used: 6104403118832
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)