Clone Name | rbastl54h12 |
---|---|
Clone Library Name | barley_pub |
>emb|CR382292.9| Zebrafish DNA sequence from clone DKEY-96L17 in linkage group 5, complete sequence Length = 178208 Score = 44.1 bits (22), Expect = 0.11 Identities = 22/22 (100%) Strand = Plus / Plus Query: 32 catgacatttattgccatgtac 53 |||||||||||||||||||||| Sbjct: 130498 catgacatttattgccatgtac 130519
>emb|BX323038.3| Zebrafish DNA sequence from clone DKEYP-57D7 in linkage group 1, complete sequence Length = 87548 Score = 44.1 bits (22), Expect = 0.11 Identities = 22/22 (100%) Strand = Plus / Minus Query: 32 catgacatttattgccatgtac 53 |||||||||||||||||||||| Sbjct: 10888 catgacatttattgccatgtac 10867
>emb|BX936452.24| Zebrafish DNA sequence from clone CH211-282C13 in linkage group 13, complete sequence Length = 136110 Score = 42.1 bits (21), Expect = 0.42 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 catgacatttattgccatgta 52 ||||||||||||||||||||| Sbjct: 16063 catgacatttattgccatgta 16043
>emb|AL935324.8| Zebrafish DNA sequence from clone CH211-197B6 in linkage group 10, complete sequence Length = 197730 Score = 42.1 bits (21), Expect = 0.42 Identities = 21/21 (100%) Strand = Plus / Minus Query: 55 cgcctagcaaatgggagagag 75 ||||||||||||||||||||| Sbjct: 132170 cgcctagcaaatgggagagag 132150
>emb|CR388077.11| Zebrafish DNA sequence from clone CH211-286E11 in linkage group 8, complete sequence Length = 192705 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 atttaccatgacatttattgccat 49 |||| ||||||||||||||||||| Sbjct: 181438 attttccatgacatttattgccat 181415
>emb|CR361543.9| Zebrafish DNA sequence from clone CH211-25E11 in linkage group 8, complete sequence Length = 66809 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 atttaccatgacatttattgccat 49 ||||| |||||||||||||||||| Sbjct: 7238 atttaacatgacatttattgccat 7215
>emb|AL137878.11| Human DNA sequence from clone RP11-145J3 on chromosome 13 Contains the 3' end of the EPSTI1 gene for epithelial stromal interaction 1 (breast), a novel gene and a pseudogene, complete sequence Length = 87358 Score = 40.1 bits (20), Expect = 1.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 32 catgacatttattgccatgt 51 |||||||||||||||||||| Sbjct: 16168 catgacatttattgccatgt 16149
>emb|BX548071.7| Zebrafish DNA sequence from clone DKEY-25L23 in linkage group 9, complete sequence Length = 223099 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 atttaccatgacatttattgccat 49 ||||| |||||||||||||||||| Sbjct: 125126 atttaacatgacatttattgccat 125149
>emb|CR847543.13| Zebrafish DNA sequence from clone DKEY-183P4 in linkage group 8, complete sequence Length = 207382 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 atttaccatgacatttattgccat 49 ||||| |||||||||||||||||| Sbjct: 192648 atttaacatgacatttattgccat 192671
>emb|BX323602.7| Zebrafish DNA sequence from clone RP71-61H23, complete sequence Length = 156514 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 atttaccatgacatttattgccat 49 ||||| |||||||||||||||||| Sbjct: 10463 atttaacatgacatttattgccat 10440
>emb|BX004888.9| Zebrafish DNA sequence from clone DKEY-8F21 in linkage group 1, complete sequence Length = 219280 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 atttaccatgacatttattgccat 49 ||||||| |||||||||||||||| Sbjct: 141204 atttaccttgacatttattgccat 141181
>emb|BX470204.13| Zebrafish DNA sequence from clone CH211-63C23 in linkage group 10, complete sequence Length = 185190 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 atttaccatgacatttattgccat 49 ||||||||| |||||||||||||| Sbjct: 65279 atttaccataacatttattgccat 65302
>emb|AL954309.11| Zebrafish DNA sequence from clone CH211-213D2 in linkage group 8, complete sequence Length = 209195 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 atttaccatgacatttattgccat 49 ||||| |||||||||||||||||| Sbjct: 134576 atttaacatgacatttattgccat 134553
>emb|BX072550.6| Zebrafish DNA sequence from clone DKEY-24P1 in linkage group 15, complete sequence Length = 229061 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 atttaccatgacatttattgccat 49 ||||| |||||||||||||||||| Sbjct: 79692 atttaacatgacatttattgccat 79715
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 atgtacacgcctagcaaat 66 ||||||||||||||||||| Sbjct: 475450 atgtacacgcctagcaaat 475468
>gb|AE017263.1| Mesoplasma florum L1 complete genome Length = 793224 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 26 atttaccatgacatttatt 44 ||||||||||||||||||| Sbjct: 496739 atttaccatgacatttatt 496721
>emb|CT030383.1| Xenopus tropicalis finished cDNA, clone TEgg113c22 Length = 4368 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 23 aggatttaccatgacattt 41 ||||||||||||||||||| Sbjct: 43 aggatttaccatgacattt 61
>emb|BX950226.13| Zebrafish DNA sequence from clone CH211-105P23 in linkage group 7, complete sequence Length = 174681 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 78259 catgacatttattgccatg 78277
>ref|XM_567836.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNK01620) partial mRNA Length = 2018 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 atgtacacgcctagcaaat 66 ||||||||||||||||||| Sbjct: 296 atgtacacgcctagcaaat 314
>ref|XM_567837.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNK01620) partial mRNA Length = 1994 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 atgtacacgcctagcaaat 66 ||||||||||||||||||| Sbjct: 272 atgtacacgcctagcaaat 290
>emb|CR293534.5| Zebrafish DNA sequence from clone CH211-13J1 in linkage group 6, complete sequence Length = 109426 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 76513 catgacatttattgccatg 76531
>emb|CR391949.7| Zebrafish DNA sequence from clone CH211-149B20 in linkage group 9, complete sequence Length = 162252 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 26 atttaccatgacatttatt 44 ||||||||||||||||||| Sbjct: 2399 atttaccatgacatttatt 2417
>emb|CR396587.8| Zebrafish DNA sequence from clone CH211-261P15 in linkage group 16, complete sequence Length = 91165 Score = 38.2 bits (19), Expect = 6.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 26 atttaccatgacatttattgcca 48 |||| |||||||||||||||||| Sbjct: 35101 attttccatgacatttattgcca 35079
>emb|BX957325.16| Zebrafish DNA sequence from clone CH211-117O2 in linkage group 7, complete sequence Length = 166088 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 19964 catgacatttattgccatg 19946
>emb|BX000531.11| Human DNA sequence from clone DAQB-12N14 on chromosome 6 Contains the OR2H1 gene for olfactory receptor, family 2, subfamily H, member 1, the UBDP1 pseudogene for ubiquitin D pseudogene 1, the MAS1L gene for MAS1 oncogene-like, the RPS17P1 pseudogene for ribosomal protein S17 pseudogene 1 and the DAQB-12N14.5 gene for a novel transcript, complete sequence Length = 89139 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 1505 agcaaatgggagagagatg 1487
>emb|BX004810.8| Human DNA sequence from clone DAQB-304F3 on chromosome 6 Contains the OR12D1P pseudogene for olfactory receptor, family 12, subfamily D, member 1, the OR11A1 gene for olfactory receptor, family 11, subfamily A, member 1, the OR10C1 gene for olfactory receptor, family 10, subfamily C, member 1 and no CpG islands, complete sequence Length = 32573 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 32078 agcaaatgggagagagatg 32060
>emb|BX247947.4| Human DNA sequence from clone DASS-372E1 on chromosome 6, complete sequence Length = 112061 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 5286 agcaaatgggagagagatg 5268
>emb|AL645927.3| Human DNA sequence from clone XXbac-13B8 on chromosome 6 contains the OR12D2, OR11A1, OR10C1 and OR2H1 genes for olfactory receptor, family 12, subfamily D, member 2, family 11, subfamily A, member 1, family 10, subfamily C, member 1 and family 2, subfamily H, member 1, the OR12D1P pseudogene for olfactory receptor, family12, subfamily D, member 1, a diubiquitin pseudogene, the MRG gene for MAS-related G protein-coupled receptor MRG and a ribosomal protein S17 (RPS17) pseudogene, complete sequence Length = 112578 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 55971 agcaaatgggagagagatg 55953
>emb|AL662869.2| Human DNA sequence from clone XXbac-128A13 on chromosome 6 contains the OR12D2, OR11A1, OR10C1 and OR2H1 genes for olfactory receptor, family 12, subfamily D, member 2, family 11, subfamily A, member 1, family 10, subfamily C, member 1, family 2, subfamily H, member 1, the gene for MAS-related G protein-coupled receptor (MRG), the OR12D1P pseudogene for olfactory receptor, family 12, subfamily D, member 1, a diubiquitin pseudogene and a ribosomal protein S17 (RPS17) pseudogene, complete sequence Length = 133836 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 52635 agcaaatgggagagagatg 52617
>emb|AL031769.1|HS194O8 Human DNA sequence from clone RP1-194O8 on chromosome 6q24.1-25.3, complete sequence Length = 126839 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 46 ccatgtacacgcctagcaa 64 ||||||||||||||||||| Sbjct: 27105 ccatgtacacgcctagcaa 27123
>emb|BX901898.15| Zebrafish DNA sequence from clone DKEY-148E3 in linkage group 1, complete sequence Length = 249378 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 89903 catgacatttattgccatg 89885
>emb|CR388393.8| Human DNA sequence from clone DADB-136A24 on chromosome 6, complete sequence Length = 159366 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 77443 agcaaatgggagagagatg 77425
>emb|CR848056.4| Human DNA sequence from clone DAAP-34I1 on chromosome 6, complete sequence Length = 28527 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 25021 agcaaatgggagagagatg 25003
>emb|BX005437.5| Zebrafish DNA sequence from clone CH211-158M21 in linkage group 7, complete sequence Length = 180673 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 34 tgacatttattgccatgta 52 ||||||||||||||||||| Sbjct: 137890 tgacatttattgccatgta 137908
>emb|CR759768.2| Human DNA sequence from clone DAMC-143I21 on chromosome 6, complete sequence Length = 123752 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 32082 agcaaatgggagagagatg 32064
>gb|AC104608.7| Drosophila melanogaster X BAC RP98-35A18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 174893 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 38 atttattgccatgtacacg 56 ||||||||||||||||||| Sbjct: 13907 atttattgccatgtacacg 13889
>gb|AC104606.6| Drosophila melanogaster X BAC RP98-26L11 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 183105 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 38 atttattgccatgtacacg 56 ||||||||||||||||||| Sbjct: 181121 atttattgccatgtacacg 181103
>emb|BX649403.4| Zebrafish DNA sequence from clone CH211-153M11 in linkage group 13, complete sequence Length = 170097 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 144608 catgacatttattgccatg 144590
>gb|AC148528.15| Medicago truncatula clone mth2-53h4, complete sequence Length = 141776 Score = 38.2 bits (19), Expect = 6.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 23 aggatttaccatgacatttattg 45 |||||||||||||| |||||||| Sbjct: 139875 aggatttaccatgaaatttattg 139853
>emb|BX649275.5| Zebrafish DNA sequence from clone CH211-199K7 in linkage group 24, complete sequence Length = 118765 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 57 cctagcaaatgggagagag 75 ||||||||||||||||||| Sbjct: 111652 cctagcaaatgggagagag 111670
>emb|BX294371.15| Zebrafish DNA sequence from clone CH211-263B6 in linkage group 5, complete sequence Length = 152696 Score = 38.2 bits (19), Expect = 6.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 27 tttaccatgacatttattgccat 49 |||| |||||||||||||||||| Sbjct: 29058 tttaacatgacatttattgccat 29036
>emb|BX927133.5| Human DNA sequence from clone DAMA-61E19 on chromosome 6, complete sequence Length = 107459 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 46140 agcaaatgggagagagatg 46122
>emb|BX323843.9| Zebrafish DNA sequence from clone CH211-10A23 in linkage group 19, complete sequence Length = 128245 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 31 ccatgacatttattgccat 49 ||||||||||||||||||| Sbjct: 34156 ccatgacatttattgccat 34174
>emb|BX005450.9| Zebrafish DNA sequence from clone CH211-150O23, complete sequence Length = 164218 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 33657 catgacatttattgccatg 33639
>emb|BX005002.9| Zebrafish DNA sequence from clone CH211-130M12, complete sequence Length = 170274 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 103292 catgacatttattgccatg 103310
>emb|BX005424.10| Zebrafish DNA sequence from clone DKEY-3N22 in linkage group 19, complete sequence Length = 200523 Score = 38.2 bits (19), Expect = 6.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 32 catgacatttattgccatgtaca 54 |||||||||||||||||| |||| Sbjct: 128732 catgacatttattgccatataca 128710
>emb|BX120013.5| Zebrafish DNA sequence from clone DKEY-76H10, complete sequence Length = 170264 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 138034 catgacatttattgccatg 138052
>emb|BX936412.46| Zebrafish DNA sequence from clone DKEY-235H13, complete sequence Length = 178114 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 114979 catgacatttattgccatg 114997
>gb|AE003441.3| Drosophila melanogaster chromosome X, section 25 of 74 of the complete sequence Length = 285949 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 38 atttattgccatgtacacg 56 ||||||||||||||||||| Sbjct: 110727 atttattgccatgtacacg 110745
>gb|AY609897.1| Sus scrofa clone Clu_39.scr.msk.p1.Contig3, mRNA sequence Length = 857 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 57 cctagcaaatgggagagag 75 ||||||||||||||||||| Sbjct: 741 cctagcaaatgggagagag 723
>gb|AC004174.1|AC004174 Homo sapiens clone UWGC:y34b273 from 6p21, complete sequence Length = 37760 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 1960 agcaaatgggagagagatg 1978
>gb|AC004178.1|AC004178 Homo sapiens clone UWGC:y19x006 from 6p21, complete sequence Length = 36384 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 34084 agcaaatgggagagagatg 34102
>emb|AL035542.8|HS994E9 Human DNA sequence from clone RP5-994E9 on chromosome 6p21.31-22.2 Contains the OR12D2, OR11A1, OR10C1 and OR2H1 genes for olfactory receptors 12D2, 11A1, 10C1 and 2H1, olfactory receptor 12D1 pseudogene OR12D1P, a diubiquitin pseudogene, the MAS-related G protein-coupled receptor MRG gene, an RPS17 (40S ribosomal protein S17) pseudogene and GSSs, complete sequence Length = 114868 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 60 agcaaatgggagagagatg 78 ||||||||||||||||||| Sbjct: 57851 agcaaatgggagagagatg 57833
>emb|AL928967.9| Zebrafish DNA sequence from clone CH211-153A8, complete sequence Length = 186487 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 catgacatttattgccatg 50 ||||||||||||||||||| Sbjct: 57271 catgacatttattgccatg 57289
>emb|AL627166.6| Mouse DNA sequence from clone RP23-59N8 on chromosome 4, complete sequence Length = 237007 Score = 38.2 bits (19), Expect = 6.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 63 aaatgggagagagatggta 81 ||||||||||||||||||| Sbjct: 120352 aaatgggagagagatggta 120334 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,024,615 Number of Sequences: 3902068 Number of extensions: 1024615 Number of successful extensions: 67421 Number of sequences better than 10.0: 55 Number of HSP's better than 10.0 without gapping: 55 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 67311 Number of HSP's gapped (non-prelim): 110 length of query: 138 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 117 effective length of database: 17,151,101,840 effective search space: 2006678915280 effective search space used: 2006678915280 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)