ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl54h11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC093832.2| Homo sapiens BAC clone RP11-402L11 from 4, comple... 44 0.26
2gb|AC135427.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.0
3gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 42 1.0
4emb|AL512303.10| Human DNA sequence from clone RP1-249I4 on chro... 42 1.0
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.0
6gb|DP000017.1| Sus scrofa target 1 genomic scaffold 40 4.1
7gb|BC070876.1| Rattus norvegicus CDP-diacylglycerol--inositol 3-... 40 4.1
8gb|AC068594.15| Homo sapiens chromosome 17, clone RP11-285E9, co... 40 4.1
9gb|AF016672.3| Caenorhabditis elegans cosmid F56D12, complete se... 40 4.1
10gb|U80841.2| Caenorhabditis elegans cosmid C13A10, complete sequ... 40 4.1
11ref|NM_001030862.1| Gallus gallus cell-cycle related and express... 40 4.1
12gb|DQ372940.1| Gallus gallus cell-cycle related and expression-e... 40 4.1
13emb|AJ851386.1| Gallus gallus mRNA for hypothetical protein, clo... 40 4.1
14gb|AC022868.10| Homo sapiens chromosome 8, clone RP11-367E12, co... 40 4.1
15gb|AC158442.3| Sus scrofa clone RP44-406A19, complete sequence 40 4.1
16gb|BC102187.1| Bos taurus similar to CDP-diacylglycerol--inosito... 40 4.1
17ref|NM_138899.2| Rattus norvegicus CDP-diacylglycerol--inositol ... 40 4.1
18dbj|AP002791.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 4.1
19dbj|AP001790.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 4.1
20dbj|AP000652.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 4.1
21dbj|AB022890.1| Rattus norvegicus PIS1 gene for phosphatidylinos... 40 4.1
22ref|NM_001034482.1| Bos taurus similar to CDP-diacylglycerol--in... 40 4.1
23dbj|D82928.1| Rat mRNA for phosphatidylinositol synthase, comple... 40 4.1

>gb|AC093832.2| Homo sapiens BAC clone RP11-402L11 from 4, complete sequence
          Length = 187232

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 168   ctggcaaaacttggaactttgt 189
             ||||||||||||||||||||||
Sbjct: 27543 ctggcaaaacttggaactttgt 27564



to top

>gb|AC135427.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0617H07,
             complete sequence
          Length = 114135

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 40    tgccattacaacaactgaaac 60
             |||||||||||||||||||||
Sbjct: 45693 tgccattacaacaactgaaac 45713



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 149   tcgccggtaataccagctact 169
             |||||||||||||||||||||
Sbjct: 55449 tcgccggtaataccagctact 55429



to top

>emb|AL512303.10| Human DNA sequence from clone RP1-249I4 on chromosome 6 Contains the
             KIAA0441 gene and a putative novel gene, complete sequence
          Length = 106408

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 114   gtagctcagcattacattgtc 134
             |||||||||||||||||||||
Sbjct: 41276 gtagctcagcattacattgtc 41296



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 40      tgccattacaacaactgaaac 60
               |||||||||||||||||||||
Sbjct: 5838929 tgccattacaacaactgaaac 5838949



to top

>gb|DP000017.1| Sus scrofa target 1 genomic scaffold
          Length = 1471440

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    tgatattttgctatttgtac 218
              ||||||||||||||||||||
Sbjct: 105002 tgatattttgctatttgtac 104983



to top

>gb|BC070876.1| Rattus norvegicus CDP-diacylglycerol--inositol
           3-phosphatidyltransferase (phosphatidylinositol
           synthase), mRNA (cDNA clone MGC:91485 IMAGE:7096385),
           complete cds
          Length = 1890

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  caggctcatgctgagctgga 105
           ||||||||||||||||||||
Sbjct: 694 caggctcatgctgagctgga 675



to top

>gb|AC068594.15| Homo sapiens chromosome 17, clone RP11-285E9, complete sequence
          Length = 168501

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 229   aggctgtataaataggctct 248
             ||||||||||||||||||||
Sbjct: 27046 aggctgtataaataggctct 27065



to top

>gb|AF016672.3| Caenorhabditis elegans cosmid F56D12, complete sequence
          Length = 44036

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   tggagcaaatttgtagctca 121
             ||||||||||||||||||||
Sbjct: 42136 tggagcaaatttgtagctca 42117



to top

>gb|U80841.2| Caenorhabditis elegans cosmid C13A10, complete sequence
          Length = 14687

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 102  tggagcaaatttgtagctca 121
            ||||||||||||||||||||
Sbjct: 2000 tggagcaaatttgtagctca 1981



to top

>ref|NM_001030862.1| Gallus gallus cell-cycle related and expression-elevated protein in
           tumor (CREPT), mRNA
          Length = 3428

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 46  tacaacaactgaaactttct 65
           ||||||||||||||||||||
Sbjct: 471 tacaacaactgaaactttct 490



to top

>gb|DQ372940.1| Gallus gallus cell-cycle related and expression-elevated protein in
           tumor (CREPT) mRNA, complete cds
          Length = 1148

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 46  tacaacaactgaaactttct 65
           ||||||||||||||||||||
Sbjct: 448 tacaacaactgaaactttct 467



to top

>emb|AJ851386.1| Gallus gallus mRNA for hypothetical protein, clone 1d17
          Length = 3428

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 46  tacaacaactgaaactttct 65
           ||||||||||||||||||||
Sbjct: 471 tacaacaactgaaactttct 490



to top

>gb|AC022868.10| Homo sapiens chromosome 8, clone RP11-367E12, complete sequence
          Length = 166018

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 111    tttgtagctcagcattacat 130
              ||||||||||||||||||||
Sbjct: 111745 tttgtagctcagcattacat 111764



to top

>gb|AC158442.3| Sus scrofa clone RP44-406A19, complete sequence
          Length = 173956

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    tgatattttgctatttgtac 218
              ||||||||||||||||||||
Sbjct: 105002 tgatattttgctatttgtac 104983



to top

>gb|BC102187.1| Bos taurus similar to CDP-diacylglycerol--inositol
           3-phosphatidyltransferase (phosphatidylinositol
           synthase), mRNA (cDNA clone MGC:127038 IMAGE:7941929),
           complete cds
          Length = 1587

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  caggctcatgctgagctgga 105
           ||||||||||||||||||||
Sbjct: 650 caggctcatgctgagctgga 631



to top

>ref|NM_138899.2| Rattus norvegicus CDP-diacylglycerol--inositol
           3-phosphatidyltransferase (phosphatidylinositol
           synthase) (Cdipt), mRNA
          Length = 1890

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  caggctcatgctgagctgga 105
           ||||||||||||||||||||
Sbjct: 694 caggctcatgctgagctgga 675



to top

>dbj|AP002791.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-843F11, complete
             sequences
          Length = 172914

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    tgctgagctggagcaaattt 113
             ||||||||||||||||||||
Sbjct: 20505 tgctgagctggagcaaattt 20486



to top

>dbj|AP001790.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-338H14, complete
            sequence
          Length = 175731

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 4    aaaattgcttcattgagttc 23
            ||||||||||||||||||||
Sbjct: 6666 aaaattgcttcattgagttc 6647



to top

>dbj|AP000652.4| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-8G5, complete
              sequence
          Length = 115530

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      aaaattgcttcattgagttc 23
              ||||||||||||||||||||
Sbjct: 114318 aaaattgcttcattgagttc 114299



to top

>dbj|AB022890.1| Rattus norvegicus PIS1 gene for phosphatidylinositol synthase,
            complete cds
          Length = 3890

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 86   caggctcatgctgagctgga 105
            ||||||||||||||||||||
Sbjct: 1778 caggctcatgctgagctgga 1759



to top

>ref|NM_001034482.1| Bos taurus similar to CDP-diacylglycerol--inositol
           3-phosphatidyltransferase (phosphatidylinositol
           synthase) (MGC127038), mRNA
          Length = 1587

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  caggctcatgctgagctgga 105
           ||||||||||||||||||||
Sbjct: 650 caggctcatgctgagctgga 631



to top

>dbj|D82928.1| Rat mRNA for phosphatidylinositol synthase, complete cds
          Length = 1621

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  caggctcatgctgagctgga 105
           ||||||||||||||||||||
Sbjct: 442 caggctcatgctgagctgga 423


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,624,392
Number of Sequences: 3902068
Number of extensions: 2624392
Number of successful extensions: 59365
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59299
Number of HSP's gapped (non-prelim): 66
length of query: 310
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 288
effective length of database: 17,147,199,772
effective search space: 4938393534336
effective search space used: 4938393534336
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top