ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl54h06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL035468.3|HS424E5 Human DNA sequence from clone RP3-424E5 o... 42 0.67
2gb|AC130713.4| Mus musculus BAC clone RP23-316K10 from chromosom... 40 2.7
3gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome... 40 2.7
4gb|AC102225.9| Mus musculus chromosome 18, clone RP24-406O24, co... 40 2.7
5emb|AL354800.4| Human DNA sequence from clone RP1-316I5 on chrom... 40 2.7
6emb|AL161450.14| Human DNA sequence from clone RP11-39K24 on chr... 40 2.7
7ref|XM_962885.1| PREDICTED: Tribolium castaneum similar to CG222... 40 2.7

>emb|AL035468.3|HS424E5 Human DNA sequence from clone RP3-424E5 on chromosome 6q13-14.3,
             complete sequence
          Length = 93805

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 38    aaggcaagaattatagaagat 58
             |||||||||||||||||||||
Sbjct: 24606 aaggcaagaattatagaagat 24626



to top

>gb|AC130713.4| Mus musculus BAC clone RP23-316K10 from chromosome 15, complete
             sequence
          Length = 192020

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 183   gatcccaaccattggcttccgtgc 206
             |||||||||||| |||||||||||
Sbjct: 17953 gatcccaaccatgggcttccgtgc 17930



to top

>gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome 18, complete sequence
          Length = 156239

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 129    aaaattactacagtaactaa 148
              ||||||||||||||||||||
Sbjct: 129764 aaaattactacagtaactaa 129783



to top

>gb|AC102225.9| Mus musculus chromosome 18, clone RP24-406O24, complete sequence
          Length = 208106

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 129   aaaattactacagtaactaa 148
             ||||||||||||||||||||
Sbjct: 38122 aaaattactacagtaactaa 38141



to top

>emb|AL354800.4| Human DNA sequence from clone RP1-316I5 on chromosome 20 Contains the
            3' end of the KIF3B gene for kinesin family member 3B,
            complete sequence
          Length = 18376

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 64   atccagctcagccacagcccagct 87
            |||||||||||||||| |||||||
Sbjct: 7674 atccagctcagccacaccccagct 7651



to top

>emb|AL161450.14| Human DNA sequence from clone RP11-39K24 on chromosome 9 Contains the 3'
              end of the JAK2 gene for Janus kinase 2 (a protein tyrosine
              kinase), a casein kinase pseudogene, a
              trans-prenyltransferase (TPT) pseudogene, a NADH
              dehydrogenase 6 (MTND6) pseuodgene, a  NADH dehydrogenase 1
              (MTND1) pseudogene, a cytochrome c oxidase I (MTCO1)
              pseudogene, a  cytochrome c oxidase II (MTCO2) pseudogene,
              an ATP synthase 6 (MTATP6) pseudogene, a cytochrome c
              oxidase III (MTCO3) pseudogene, a NADH dehydrogenase 4
              (MTND4)pseudogene, a pseudogene similar to part of NADH
              dehydrogenase 5 (MTND5), a transcription factor 3 (E2A
              immunoglobulin enhancer binding factors E12/E47) (TCF3)
              pseudogene, an immunoglobulin heavy constant epsilon
              pseudogene 2 (IGHEP2), a novel gene, the INSL6 gene for
              insulin-like 6 (RIF1) and 4 CpG islands, complete sequence
          Length = 171146

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     atttgtattataagcttctg 33
              ||||||||||||||||||||
Sbjct: 111515 atttgtattataagcttctg 111534



to top

>ref|XM_962885.1| PREDICTED: Tribolium castaneum similar to CG2221-PA (LOC656346),
           mRNA
          Length = 2284

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 118 aaaccgacaacaaaattactacag 141
           ||||||||||||||||| ||||||
Sbjct: 385 aaaccgacaacaaaatttctacag 408


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,616,612
Number of Sequences: 3902068
Number of extensions: 1616612
Number of successful extensions: 109687
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109677
Number of HSP's gapped (non-prelim): 10
length of query: 210
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 188
effective length of database: 17,147,199,772
effective search space: 3223673557136
effective search space used: 3223673557136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top