Clone Name | rbastl54f05 |
---|---|
Clone Library Name | barley_pub |
>emb|AL354810.8| Human DNA sequence from clone RP11-527N12 on chromosome 13 Contains a novel gene, complete sequence Length = 178323 Score = 46.1 bits (23), Expect = 0.056 Identities = 23/23 (100%) Strand = Plus / Plus Query: 92 aaaactttaggatacagtaaaaa 114 ||||||||||||||||||||||| Sbjct: 18384 aaaactttaggatacagtaaaaa 18406
>gb|AC007434.8| Homo sapiens, clone RP11-17A8, complete sequence Length = 148359 Score = 46.1 bits (23), Expect = 0.056 Identities = 23/23 (100%) Strand = Plus / Plus Query: 92 aaaactttaggatacagtaaaaa 114 ||||||||||||||||||||||| Sbjct: 39553 aaaactttaggatacagtaaaaa 39575
>gb|AC073048.7| Homo sapiens BAC clone RP11-54E21 from 7, complete sequence Length = 166183 Score = 42.1 bits (21), Expect = 0.87 Identities = 21/21 (100%) Strand = Plus / Minus Query: 96 ctttaggatacagtaaaaatg 116 ||||||||||||||||||||| Sbjct: 123158 ctttaggatacagtaaaaatg 123138
>emb|AL023283.6|HS238G2 Human DNA sequence from clone RP1-238G2 on chromosome 6q23.2-25.2, complete sequence Length = 118904 Score = 42.1 bits (21), Expect = 0.87 Identities = 21/21 (100%) Strand = Plus / Plus Query: 99 taggatacagtaaaaatgttc 119 ||||||||||||||||||||| Sbjct: 27519 taggatacagtaaaaatgttc 27539
>emb|AL627256.5| Zebrafish DNA sequence from clone RP71-1L10 in linkage group 8 Contains part of a gene for a novel peptide transporter, complete sequence Length = 169757 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 196 atatccatgtgtaaactctt 215 |||||||||||||||||||| Sbjct: 113691 atatccatgtgtaaactctt 113710
>gb|AC087310.9| Homo sapiens 12p BAC RP11-681I19 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 109567 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 tcgccttgctgcttatttta 173 |||||||||||||||||||| Sbjct: 67584 tcgccttgctgcttatttta 67565
>gb|AC068476.13| Homo sapiens chromosome 8, clone RP11-374B17, complete sequence Length = 205196 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 190 aagtacatatccatgtgtaa 209 |||||||||||||||||||| Sbjct: 153961 aagtacatatccatgtgtaa 153980
>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence Length = 143903 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 gatacagtaaaaatgttctg 121 |||||||||||||||||||| Sbjct: 69204 gatacagtaaaaatgttctg 69223
>gb|AC008051.3|F19C14 Sequence of BAC F19C14 from Arabidopsis thaliana chromosome 1, complete sequence Length = 86014 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 aggatacagtaaaaatgttc 119 |||||||||||||||||||| Sbjct: 34247 aggatacagtaaaaatgttc 34228
>emb|AL732506.10| Mouse DNA sequence from clone RP23-195K8 on chromosome 4, complete sequence Length = 178592 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 232 taaatatacctgctttcagctacc 255 ||||||||||||||||||| |||| Sbjct: 55416 taaatatacctgctttcagatacc 55393
>gb|AC092957.6| Homo sapiens 3 BAC RP11-635I10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 161585 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 246 ttcagctaccatctttgtcc 265 |||||||||||||||||||| Sbjct: 76833 ttcagctaccatctttgtcc 76814 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,385,812 Number of Sequences: 3902068 Number of extensions: 2385812 Number of successful extensions: 39223 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 39205 Number of HSP's gapped (non-prelim): 18 length of query: 265 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 243 effective length of database: 17,147,199,772 effective search space: 4166769544596 effective search space used: 4166769544596 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)