>emb|CR354401.17| Zebrafish DNA sequence from clone CH211-101C7 in linkage group 12,
              complete sequence
          Length = 168372

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    tagttacatcacaaatgtat 171
              ||||||||||||||||||||
Sbjct: 110978 tagttacatcacaaatgtat 110959

>emb|CR293518.13| Zebrafish DNA sequence from clone CH211-129L10 in linkage group 12,
              complete sequence
          Length = 196374

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    tagttacatcacaaatgtat 171
              ||||||||||||||||||||
Sbjct: 146452 tagttacatcacaaatgtat 146433

>gb|AC113188.6| Homo sapiens chromosome 8, clone CTD-2546M19, complete sequence
          Length = 194602

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   tttcctcgcccatcatcttg 195
             ||||||||||||||||||||
Sbjct: 46859 tttcctcgcccatcatcttg 46840

>gb|AC160650.2| Pan troglodytes BAC clone CH251-548K10 from chromosome unknown,
             complete sequence
          Length = 184125

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   tttcctcgcccatcatcttg 195
             ||||||||||||||||||||
Sbjct: 61040 tttcctcgcccatcatcttg 61021

>gb|AC163744.3| Pan troglodytes BAC clone CH251-376E11 from chromosome unknown,
             complete sequence
          Length = 195342

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   tttcctcgcccatcatcttg 195
             ||||||||||||||||||||
Sbjct: 45594 tttcctcgcccatcatcttg 45613

>gb|AC175061.3| Pan troglodytes BAC clone CH251-572M8 from chromosome unknown, complete
              sequence
          Length = 191409

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    tttcctcgcccatcatcttg 195
              ||||||||||||||||||||
Sbjct: 161527 tttcctcgcccatcatcttg 161508

>gb|AC084637.1|CBRG45I03 Caenorhabditis briggsae cosmid G45I03, complete sequence
          Length = 39132

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     caaaattccaaatttcattg 24
             ||||||||||||||||||||
Sbjct: 28489 caaaattccaaatttcattg 28470

>emb|CT573313.6| H.melpomene DNA sequence from clone AEHM-46M10, complete sequence
          Length = 112576

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 152   tagttacatcacaaatgtat 171
             ||||||||||||||||||||
Sbjct: 41211 tagttacatcacaaatgtat 41192

>emb|AL844531.6| Mouse DNA sequence from clone RP23-211J18 on chromosome 2, complete
             sequence
          Length = 181194

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     caaaattccaaatttcattg 24
             ||||||||||||||||||||
Sbjct: 57411 caaaattccaaatttcattg 57430

>dbj|AP004295.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1907E5
          Length = 154597

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    tttcctcgcccatcatcttg 195
              ||||||||||||||||||||
Sbjct: 136737 tttcctcgcccatcatcttg 136718


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,861,971
Number of Sequences: 3902068
Number of extensions: 1861971
Number of successful extensions: 130982
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 130960
Number of HSP's gapped (non-prelim): 22
length of query: 201
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 179
effective length of database: 17,147,199,772
effective search space: 3069348759188
effective search space used: 3069348759188
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)