ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl54d06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC131794.3| Mus musculus BAC clone RP24-486P14 from chromosom... 44 0.33
2gb|AC153012.4| Mus musculus BAC clone RP23-302F19 from chromosom... 44 0.33
3gb|AF512737.1| Loxocemus bicolor 12S ribosomal RNA gene, partial... 42 1.3
4gb|AC116877.18| Mus musculus chromosome 18, clone RP24-429E21, c... 40 5.1
5gb|AC131756.3| Mus musculus BAC clone RP24-199J23 from chromosom... 40 5.1
6gb|AC113483.7| Mus musculus chromosome 1, clone RP23-343E12, com... 40 5.1
7gb|BT011074.1| Drosophila melanogaster SD14261 full insert cDNA 40 5.1
8emb|AL354653.26| Human DNA sequence from clone RP11-326A14 on ch... 40 5.1
9gb|AC078829.10| Oryza sativa chromosome 10 BAC OSJNBa0026O12 gen... 40 5.1
10dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.1
11gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.1
12dbj|AP005270.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 5.1

>gb|AC131794.3| Mus musculus BAC clone RP24-486P14 from chromosome 9, complete sequence
          Length = 166272

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 167    taatacaatgtgtagattatgt 188
              ||||||||||||||||||||||
Sbjct: 144108 taatacaatgtgtagattatgt 144129



to top

>gb|AC153012.4| Mus musculus BAC clone RP23-302F19 from chromosome 9, complete sequence
          Length = 196764

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 167    taatacaatgtgtagattatgt 188
              ||||||||||||||||||||||
Sbjct: 112873 taatacaatgtgtagattatgt 112894



to top

>gb|AF512737.1| Loxocemus bicolor 12S ribosomal RNA gene, partial sequence; tRNA-Val
            gene, complete sequence; and 16S ribosomal RNA gene,
            partial sequence; mitochondrial genes for mitochondrial
            products
          Length = 1844

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 188  tactagaaatcaacagaccaaaaaa 212
            |||||| ||||||||||||||||||
Sbjct: 1193 tactagcaatcaacagaccaaaaaa 1217



to top

>gb|AC116877.18| Mus musculus chromosome 18, clone RP24-429E21, complete sequence
          Length = 188544

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 109    atgtgtagattgtaatacaa 128
              ||||||||||||||||||||
Sbjct: 106759 atgtgtagattgtaatacaa 106740



to top

>gb|AC131756.3| Mus musculus BAC clone RP24-199J23 from chromosome 19, complete
             sequence
          Length = 175604

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 21    gtatatatacaaaatcagtataca 44
             ||||||||| ||||||||||||||
Sbjct: 79503 gtatatataaaaaatcagtataca 79480



to top

>gb|AC113483.7| Mus musculus chromosome 1, clone RP23-343E12, complete sequence
          Length = 207188

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 231    aattgttggcctcatcaaca 250
              ||||||||||||||||||||
Sbjct: 114580 aattgttggcctcatcaaca 114561



to top

>gb|BT011074.1| Drosophila melanogaster SD14261 full insert cDNA
          Length = 1487

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 193  gaaatcaacagaccaaaaaa 212
            ||||||||||||||||||||
Sbjct: 1455 gaaatcaacagaccaaaaaa 1474



to top

>emb|AL354653.26| Human DNA sequence from clone RP11-326A14 on chromosome Xq13.3-21.2
             Contains the 3' end of the RPS6KA6 gene for ribosomal
             protein S6 kinase, complete sequence
          Length = 173760

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    atacaaaatcagtatacaca 46
             ||||||||||||||||||||
Sbjct: 47621 atacaaaatcagtatacaca 47640



to top

>gb|AC078829.10| Oryza sativa chromosome 10 BAC OSJNBa0026O12 genomic sequence, complete
             sequence
          Length = 163279

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   atcaacagaccaaaaaattt 215
             ||||||||||||||||||||
Sbjct: 34149 atcaacagaccaaaaaattt 34130



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 196      atcaacagaccaaaaaattt 215
                ||||||||||||||||||||
Sbjct: 17338130 atcaacagaccaaaaaattt 17338149



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 196      atcaacagaccaaaaaattt 215
                ||||||||||||||||||||
Sbjct: 17347170 atcaacagaccaaaaaattt 17347189



to top

>dbj|AP005270.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-291B19, complete
              sequence
          Length = 200493

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     ttcagatcaatatgttcaat 86
              ||||||||||||||||||||
Sbjct: 145358 ttcagatcaatatgttcaat 145339


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,960,934
Number of Sequences: 3902068
Number of extensions: 3960934
Number of successful extensions: 77835
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77766
Number of HSP's gapped (non-prelim): 69
length of query: 384
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 362
effective length of database: 17,147,199,772
effective search space: 6207286317464
effective search space used: 6207286317464
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top