ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl54d05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC091119.2| Canis familiaris clone RP81-142A6, complete sequence Length = 150149 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatctagctacc 110 ||||||||||||||||||| ||||||| ||||| Sbjct: 53827 atccatccatccatccacccacatctacctacc 53859
>emb|AL161658.21| Human DNA sequence from clone RP11-470C13 on chromosome 20 Contains the 3' end of the gene for KIAA1272 protein (similar to rat tulip proteins 1 and 2), the INSM1 gene for insulinoma-associated protein 1, the 3' end of the C20orf26 gene and a CpG island, complete sequence Length = 67356 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaacatcta 104 ||||||||||||||||||| ||||||| Sbjct: 4162 atccatccatccatccacccacatcta 4136
>gb|AC103874.2| Homo sapiens chromosome 15, clone RP11-907B8, complete sequence Length = 158897 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaacatcta 104 ||||||||||||||||| ||||||||| Sbjct: 87759 atccatccatccatccatcaacatcta 87733
>emb|AL606925.16| Mouse DNA sequence from clone RP23-12J1 on chromosome 4, complete sequence Length = 239244 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccaccaac 99 ||||||||||||||||||||||| Sbjct: 173780 gatccatccatccatccaccaac 173758
>gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, complete sequence Length = 214765 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 27295 atccatccatccatccaccaac 27316
>ref|XM_914623.2| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik), mRNA Length = 3942 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 2449 atccatccatccatccaccaac 2470
>gb|AC067941.7| Homo sapiens BAC clone RP11-815K3 from 7, complete sequence Length = 215994 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 11618 atccatccatccatccaccaac 11639
>ref|XM_983707.1| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik), mRNA Length = 3926 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 2433 atccatccatccatccaccaac 2454
>ref|XM_194378.6| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik), mRNA Length = 3926 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 2433 atccatccatccatccaccaac 2454
>gb|AC146479.2| Pan troglodytes BAC clone CH251-424F5 from Y, complete sequence Length = 163250 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 138981 atccatccatccatccaccaac 139002
>emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chromosome X, complete sequence Length = 154563 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 116329 atccatccatccatccaccaac 116308
>gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosome 7, complete sequence Length = 199810 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 36335 atccatccatccatccaccaac 36356
>gb|AC146478.2| Pan troglodytes BAC clone CH251-409D17 from Y, complete sequence Length = 149556 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 39483 atccatccatccatccaccaac 39504
>gb|AC101490.8| Mus musculus chromosome 3, clone RP23-188O2, complete sequence Length = 247848 Score = 44.1 bits (22), Expect = 0.24 Identities = 25/26 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatct 103 ||||||||||||||||| |||||||| Sbjct: 83214 atccatccatccatccagcaacatct 83239
>emb|AL445199.37| Human DNA sequence from clone RP13-439H18 on chromosome 10 Contains the GPR123 gene for G protein-coupled receptor 123, a novel gene (containing KIAA1768, FLJ00378 and FLJ00252), gene FLJ25027, the UTF1 gene for undifferentiated embryonic cell transcription factor 1, the 5' end of the VENTX2 gene for VENT-like homeobox2, a novel gene, a 60S ribosomal protein L5 (RPL5) pseudogene and twenty five CpG islands, complete sequence Length = 212199 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 35705 atccatccatccatccaccaac 35684 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 35565 atccatccatccatccaccaac 35544 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 35433 atccatccatccatccaccaac 35412
>emb|BX908382.8| Human DNA sequence from clone WI2-87105E3 on chromosome X Contains the 5' end of the CRLF2 gene for cytokine receptor-like factor 2, complete sequence Length = 33657 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 31461 atccatccatccatccaccaac 31440
>emb|AL136528.11| Human DNA sequence from clone RP5-1092A11 on chromosome 1p36.2-36.33 Contains the 5' end of the gene for a novel protein (FLJ32825), a novel gene (KIAA0495), two novel genes, the TP73 gene for tumor protein p73, the 5' end of the WDR8 gene for WD repeat domain 8 and five CpG islands, complete sequence Length = 138941 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 42356 atccatccatccatccaccaac 42377
>emb|AL035588.21|HS696P19 Human DNA sequence from clone RP4-696P19 on chromosome 6p12.3-21.2 Contains the 3' end of the TFEB gene for transcription factor EB (TCFEB), a nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) pseudogene, the MDFI gene for MyoD family inhibitor, the 5' end of a novel gene and two CpG islands, complete sequence Length = 110665 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 22170 atccatccatccatccaccaac 22191
>gb|AC148836.6| Pan troglodytes BAC clone CH251-2C8 from chromosome 7, complete sequence Length = 219717 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 39674 atccatccatccatccaccaac 39653
>emb|BX511261.12| Zebrafish DNA sequence from clone DKEYP-59G7 in linkage group 1, complete sequence Length = 185266 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccaccaa 98 |||||||||||||||||||||| Sbjct: 153133 gatccatccatccatccaccaa 153112 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 152956 atccatccatccatccaccaa 152936 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 152776 atccatccatccatccaccaa 152756 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 152608 atccatccatccatccaccaa 152588 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 152444 atccatccatccatccaccaa 152424 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 152028 atccatccatccatccaccaa 152008
>emb|BX663524.6| Zebrafish DNA sequence from clone DKEY-97K15, complete sequence Length = 196030 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 12695 atccatccatccatccaccaac 12674
>dbj|BS000632.2| Pan troglodytes chromosome Y clone: PTB-399O20, complete sequence Length = 199770 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 64182 atccatccatccatccaccaac 64203
>emb|BX548247.6| Zebrafish DNA sequence from clone DKEY-177G18 in linkage group 23, complete sequence Length = 180406 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 108017 atccatccatccatccaccaac 107996
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 17658236 atccatccatccatccaccaac 17658215
>gb|AC109580.14| Danio rerio strain AB clone busm1-183j13, complete sequence Length = 94348 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 82413 atccatccatccatccaccaac 82434
>emb|BX323839.13| Zebrafish DNA sequence from clone CH211-217K17 in linkage group 1, complete sequence Length = 155358 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 118465 atccatccatccatccaccaac 118486
>emb|BX247866.12| Zebrafish DNA sequence from clone DKEY-216J12 in linkage group 1, complete sequence Length = 197473 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccaccaa 98 |||||||||||||||||||||| Sbjct: 156910 gatccatccatccatccaccaa 156889
>dbj|AK090234.1| Mus musculus 16 days neonate male diencephalon cDNA, RIKEN full-length enriched library, clone:G630023A01 product:unclassifiable, full insert sequence Length = 1920 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 429 atccatccatccatccaccaac 450
>emb|AL929518.16| Zebrafish DNA sequence from clone CH211-163F10 in linkage group 2, complete sequence Length = 162473 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 144328 atccatccatccatccaccaac 144349 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 144300 atccatccatccatccaccaac 144321
>emb|AL929396.18| Zebrafish DNA sequence from clone CH211-93G23 in linkage group 1, complete sequence Length = 169067 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 45185 atccatccatccatccaccaac 45164
>gb|AC003663.1|AC003663 Homo sapiens chromosome 17, clone HCIT87G17, complete sequence Length = 132070 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 28064 atccatccatccatccaccaac 28043
>gb|AC150648.2| Mus musculus BAC clone RP23-235N5 from 7, complete sequence Length = 190414 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 122158 atccatccatccatccaccaac 122179
>gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, complete sequence Length = 210710 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 55047 atccatccatccatccaccaac 55026
>emb|AL954313.6| Zebrafish DNA sequence from clone CH211-257J20 in linkage group 11, complete sequence Length = 156381 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 84666 atccatccatccatccaccaac 84645 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 84626 atccatccatccatccaccaac 84605 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 84245 atccatccatccatccaccaac 84224
>gb|AC161433.5| Mus musculus chromosome 8, clone RP23-50F12, complete sequence Length = 253440 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 190637 atccatccatccatccaccaac 190658
>emb|AL672259.9| Mouse DNA sequence from clone RP23-169M4 on chromosome 2, complete sequence Length = 179832 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaac 99 |||||||||||||||||||||| Sbjct: 96402 atccatccatccatccaccaac 96423
>gb|AC153851.27| Mus musculus 6 BAC RP23-61N4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 217854 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 46 ctacatataacatacagagtc 66 ||||||||||||||||||||| Sbjct: 52645 ctacatataacatacagagtc 52625 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 46 ctacatataacatacagagtc 66 ||||||||||||||||||||| Sbjct: 30498 ctacatataacatacagagtc 30518
>gb|AY559433.1| Thielaviopsis basicola clone NG3/NG4 ISSR sequence Length = 439 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 130 atccatccatccatccaccaa 150
>gb|AY169492.1| Oryza latifolia isolate 100914 clone 2 alcohol dehydrogenase II (adh2) gene, exons 3 through 7 and partial cds Length = 1648 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacca 97 ||||||||||||||||||||| Sbjct: 54 gatccatccatccatccacca 34
>gb|AE000663.1|MMAE000663 Mus musculus TCR beta locus from bases 1 to 250611 (section 1 of 3) of the complete sequence Length = 250611 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 46 ctacatataacatacagagtc 66 ||||||||||||||||||||| Sbjct: 115437 ctacatataacatacagagtc 115417 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 46 ctacatataacatacagagtc 66 ||||||||||||||||||||| Sbjct: 93292 ctacatataacatacagagtc 93312
>gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, complete sequence Length = 190426 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 5838 atccatccatccatccaccaa 5818
>gb|AC010976.6| Homo sapiens BAC clone RP11-286H15 from 2, complete sequence Length = 204142 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 97618 atccatccatccatccaccaa 97638
>gb|AY498860.1| Homo sapiens tumor necrosis factor receptor superfamily, member 8 (TNFRSF8) gene, complete cds Length = 84102 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 748 atccatccatccatccaccaa 768
>emb|BX927112.16| Zebrafish DNA sequence from clone DKEY-109M11 in linkage group 1, complete sequence Length = 131888 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 102816 atccatccatccatccaccaa 102836
>emb|BX936415.10| Zebrafish DNA sequence from clone CH211-242N18 in linkage group 6, complete sequence Length = 176089 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 79 tccatccatccatccaccaac 99 ||||||||||||||||||||| Sbjct: 106702 tccatccatccatccaccaac 106682
>emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in linkage group 23, complete sequence Length = 201764 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 70164 atccatccatccatccaccaa 70184 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 92495 atccatccatccatccacca 92476
>gb|AC122058.4| Mus musculus BAC clone RP24-468G7 from chromosome 14, complete sequence Length = 143331 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 110960 atccatccatccatccaccaa 110980
>gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, complete sequence Length = 208417 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 186867 atccatccatccatccaccaa 186887
>gb|AC127567.4| Mus musculus BAC clone RP24-191P12 from chromosome 6, complete sequence Length = 185620 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 27891 atccatccatccatccaccaa 27911
>gb|AC121930.3| Mus musculus BAC clone RP24-205C1 from chromosome 15, complete sequence Length = 148390 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 119013 atccatccatccatccaccaa 119033
>gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete sequence Length = 167771 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 122547 atccatccatccatccaccaa 122527
>emb|CR376783.22| Zebrafish DNA sequence from clone DKEY-41N20 in linkage group 13, complete sequence Length = 205064 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 11602 atccatccatccatccaccaa 11582 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 11103 atccatccatccatccaccaa 11083
>gb|AC108430.11| Mus musculus chromosome 14, clone RP23-166L19, complete sequence Length = 204251 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 191474 atccatccatccatccaccaa 191494
>gb|AC004906.3| Homo sapiens PAC clone RP5-852O24 from 7, complete sequence Length = 97749 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 46123 atccatccatccatccaccaa 46103
>emb|CR925794.8| Zebrafish DNA sequence from clone CH211-202A23 in linkage group 13, complete sequence Length = 132763 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 26534 atccatccatccatccaccaa 26554
>emb|CR762417.10| Zebrafish DNA sequence from clone DKEY-229E7 in linkage group 5, complete sequence Length = 78646 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 76044 atccatccatccatccaccaa 76064
>emb|Z85994.1|HS32I10 Human DNA sequence from clone RP1-32I10 on chromosome 22, complete sequence Length = 93312 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 689 atccatccatccatccaccaa 669
>emb|AL929500.4| Human DNA sequence from clone CITF22-57B10 on chromosome 22, complete sequence Length = 8930 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 7619 atccatccatccatccaccaa 7599
>emb|AL591386.19| Human DNA sequence from clone RP11-349K21 on chromosome 9, complete sequence Length = 69657 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 44798 atccatccatccatccaccaccatc 44822 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 44776 atccatccatccatccaccaccatc 44800 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 44522 atccatccatccatccaccaccatc 44546 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 44500 atccatccatccatccaccaccatc 44524 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 44330 atccatccatccatccaccaccatc 44354 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 44308 atccatccatccatccaccaccatc 44332 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 44263 atccatccatccatccaccaccatc 44287 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 44582 atccatccatccatccacca 44601 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 44188 atccatccatccatccacca 44207 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 44154 atccatccatccatccacca 44173 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 44132 atccatccatccatccacca 44151 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 44110 atccatccatccatccacca 44129 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 43983 atccatccatccatccacca 44002 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 43621 atccatccatccatccacca 43640
>emb|AL499625.4| Human DNA sequence from clone LA20-66F10 on chromosome 20 Contains part of the BPI gene for bactericidal/permeability-increasing protein and part of a novel gene, complete sequence Length = 12916 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 3095 atccatccatccatccaccaa 3075
>emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chromosome 1 Contains the TNFRSF8 gene for tumor necrosis factor receptor superfamily member 8, a ribosomal protein L23a (RPL23A) pseudogene, the 5' end of the TNFRSF1B gene for tumor necrosis factor receptor superfamily member 1B and three CpG islands, complete sequence Length = 151498 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 16370 atccatccatccatccaccaa 16390
>emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K14 on chromosome 20 Contains the C20orf148 gene for a novel tyrosine kinase, the PTK6 gene for protein tyrosine kinase 6, a novel gene, the EEF1A2 gene for eukaryotic translation elongation factor 1 alpha 2, the 5' end of the KCNQ2 gene for potassium voltage-gated channel (KQT-like subfamily member 2), the gene for peroxisomal proliferator-activated receptor A interacting complex 285 (PRIC285)(FLJ00244, KIAA1769), the C20orf149 gene, the gene for novel protein MGC5356 (MGC5356), the gene for a novel protein (LOC200213), a novel gene and thirteen CpG islands, complete sequence Length = 113196 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 20788 atccatccatccatccaccaa 20768
>emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C3 on chromosome 20 Contains the C20orf185 gene for the possible ortholog of potential ligand_binding protein RYA3 (Rat), the C20orf186 gene for the possible ortholog of potential ligand_binding protein RY2G5 (Rat), the 5' end of the SPAG4L gene for sperm associated antigen 4-like, a novel gene, a FAM16AX (family with sequence similarity 16, member A, X-linked) pseudogene, the BPIL3 gene for bactericidal/permeability-increasing protein-like 3 and a CpG island, complete sequence Length = 129502 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 105528 atccatccatccatccaccaa 105548
>emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10 on chromosome 22q11.21-12.1, complete sequence Length = 114231 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 71799 atccatccatccatccaccaa 71819
>emb|X15400.1|DMGLASS Drosophila glass gene encoding a zinc finger protein Length = 9954 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacca 97 ||||||||||||||||||||| Sbjct: 3853 gatccatccatccatccacca 3833
>emb|AL591174.13| Mouse DNA sequence from clone RP23-271B20 on chromosome 11, complete sequence Length = 205379 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 99954 atccatccatccatccaccaa 99974
>emb|CR759869.14| Zebrafish DNA sequence from clone DKEY-238F11 in linkage group 13, complete sequence Length = 284763 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 239386 atccatccatccatccaccaa 239366
>emb|CR925715.4| Zebrafish DNA sequence from clone CH211-212C11 in linkage group 14, complete sequence Length = 132743 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 26534 atccatccatccatccaccaa 26554
>emb|AL645842.15| Mouse DNA sequence from clone RP23-20A9 on chromosome 11 Contains two novel genes and the 3' end of the Accn1 gene for neuronal amiloride-sensitive cation channel 1 (degenerin), complete sequence Length = 114190 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 ggatccatccatccatccacc 96 ||||||||||||||||||||| Sbjct: 95821 ggatccatccatccatccacc 95801
>emb|AL954256.1| Pan troglodytes chromosome 22 clone PTB-129I16 map 22q22.3, complete sequence Length = 180777 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 106887 atccatccatccatccaccaa 106907
>gb|AC022239.16| Homo sapiens chromosome 8, clone RP11-148O21, complete sequence Length = 191630 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 ggatccatccatccatccacc 96 ||||||||||||||||||||| Sbjct: 94369 ggatccatccatccatccacc 94349
>emb|BX511168.4| Zebrafish DNA sequence from clone DKEY-22F5 in linkage group 21, complete sequence Length = 263757 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 55458 atccatccatccatccaccaa 55438
>emb|AL928995.19| Zebrafish DNA sequence from clone CH211-215M21 in linkage group 20 Contains the gene for a novel protein similar to human tubulin tyrosine ligase-like family, member 2 (TTLL2), seven genes for novel proteins similar to vertebrate pim oncogene family, two genes for transposase, seven novel genes, the 5' end of a novel gene and a CpG island, complete sequence Length = 202735 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacca 97 ||||||||||||||||||||| Sbjct: 180441 gatccatccatccatccacca 180421
>emb|BX323071.16| Zebrafish DNA sequence from clone DKEYP-51F12, complete sequence Length = 208116 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 172733 atccatccatccatccaccaa 172753
>emb|BX649302.22| Zebrafish DNA sequence from clone CH211-248I6 in linkage group 12, complete sequence Length = 154089 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 119410 atccatccatccatccaccaa 119430
>emb|CR361558.6| Zebrafish DNA sequence from clone DKEY-22K11 in linkage group 13, complete sequence Length = 204631 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 116664 atccatccatccatccaccaa 116644
>emb|BX469911.9| Zebrafish DNA sequence from clone DKEY-13K9 in linkage group 5, complete sequence Length = 226730 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 ccatccatccatccaccaacatcta 104 ||||||||||||||||| ||||||| Sbjct: 148587 ccatccatccatccacccacatcta 148563
>gb|AE014177.1| Mus musculus piebald deletion region section 5 of 11 of the complete sequence Length = 400029 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 346121 atccatccatccatccaccaa 346141
>gb|AC023711.5| Drosophila melanogaster X BAC RP98-6C4 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 174157 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Minus Query: 175 caatttccgcttctgcttcttcttc 199 ||||||| ||||||||||||||||| Sbjct: 130766 caatttcagcttctgcttcttcttc 130742
>gb|AC020912.6| Homo sapiens chromosome 19 clone CTD-2583G20, complete sequence Length = 163225 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 68875 atccatccatccatccaccaa 68855
>gb|AC008735.9| Homo sapiens chromosome 19 clone CTD-2537I9, complete sequence Length = 223879 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 133794 atccatccatccatccaccaa 133774
>emb|BX571718.9| Zebrafish DNA sequence from clone DKEYP-111A10 in linkage group 14, complete sequence Length = 168697 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 78843 atccatccatccatccaccaa 78823
>gb|AC023685.4| Drosophila melanogaster 3L BAC RP98-20N12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 167926 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Minus Query: 175 caatttccgcttctgcttcttcttc 199 ||||||| ||||||||||||||||| Sbjct: 160180 caatttcagcttctgcttcttcttc 160156
>gb|AC079955.9| Homo sapiens chromosome 10 clone RP11-134O16, complete sequence Length = 192042 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 69872 atccatccatccatccaccaa 69892
>gb|AC099494.3| Homo sapiens chromosome 16 clone RP11-1102P22, complete sequence Length = 143557 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 79 tccatccatccatccaccaac 99 ||||||||||||||||||||| Sbjct: 76599 tccatccatccatccaccaac 76579
>gb|AC090119.1|AC090119 Takifugu rubripes clone 242D16, complete sequence Length = 107344 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 5659 atccatccatccatccaccaa 5679
>emb|BX571973.15| Zebrafish DNA sequence from clone DKEY-254A11 in linkage group 22, complete sequence Length = 214325 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 44608 atccatccatccatccaccaa 44588
>gb|AC008514.8| Homo sapiens chromosome 5 clone CTC-455F18, complete sequence Length = 172525 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 167437 atccatccatccatccaccaa 167457
>gb|AC119271.11| Mus musculus chromosome 7, clone RP24-373F15, complete sequence Length = 178814 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 31509 atccatccatccatccaccaa 31489
>gb|AC093642.5| Homo sapiens BAC clone RP11-341N2 from 2, complete sequence Length = 158203 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 29212 atccatccatccatccaccaccatc 29236 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 29276 atccatccatccatccacca 29295 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 29245 atccatccatccatccacca 29264 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 29168 atccatccatccatccacca 29187 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 29066 atccatccatccatccacca 29085 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 29039 atccatccatccatccacca 29058 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 29009 atccatccatccatccacca 29028 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 28853 atccatccatccatccacca 28872 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 28626 atccatccatccatccacca 28645 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 28519 atccatccatccatccacca 28538 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 28459 atccatccatccatccacca 28478 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 28316 atccatccatccatccacca 28335
>gb|AC116910.11| Homo sapiens chromosome 17, clone CTD-2573C9, complete sequence Length = 149156 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 144179 atccatccatccatccaccaa 144199 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 144007 atccatccatccatccaccaa 144027
>gb|AC068483.6| Homo sapiens BAC clone RP11-31G7 from 2, complete sequence Length = 157285 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 39238 atccatccatccatccaccaa 39258
>gb|AC124057.12| Homo sapiens chromosome 11, clone RP5-915F1, complete sequence Length = 155082 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 104392 atccatccatccatccaccaa 104372
>gb|AC127521.11| Homo sapiens chromosome 17, clone RP13-580F15, complete sequence Length = 31450 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 31340 atccatccatccatccaccaa 31320
>gb|AC010442.7| Homo sapiens chromosome 5 clone CTD-2228K2, complete sequence Length = 153197 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 75323 atccatccatccatccaccaa 75343
>gb|AC119253.7| Mus musculus chromosome 15, clone RP24-279A15, complete sequence Length = 163503 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 141132 atccatccatccatccaccaa 141112
>gb|AC167565.1| Mus musculus BAC clone RP24-84D8 from chromosome 14, complete sequence Length = 199101 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 180778 atccatccatccatccaccaccatc 180802
>emb|AL935034.18| Zebrafish DNA sequence from clone CH211-160A3 in linkage group 12, complete sequence Length = 171213 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 90537 atccatccatccatccaccaa 90517 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 139913 atccatccatccatccacca 139932
>emb|BX247882.6| Zebrafish DNA sequence from clone CH211-224P3 in linkage group 14, complete sequence Length = 196155 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 163996 atccatccatccatccaccaa 163976
>dbj|AB025636.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MVP2 Length = 80402 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Minus Query: 174 tcaatttccgcttctgcttcttctt 198 ||||||||||||||| ||||||||| Sbjct: 46065 tcaatttccgcttcttcttcttctt 46041
>gb|AF148621.1|AF148621 Oryza latifolia alcohol dehydrogenase II (Adh2) gene, exons 3 through 7, partial cds Length = 1702 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacca 97 ||||||||||||||||||||| Sbjct: 58 gatccatccatccatccacca 38
>gb|AF112229.1|HSCD30P2 Homo sapiens CD30 protein (CD30) gene, promoter, exon 1, and partial cds Length = 936 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 204 atccatccatccatccaccaa 224
>emb|AJ311494.1|HSA311494 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's lymphoma-derived cell line L540 Length = 1612 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 1005 atccatccatccatccaccaa 1025
>emb|AJ311493.1|HSA311493 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's lymphoma-derived cell line L591 Length = 1608 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 1001 atccatccatccatccaccaa 1021
>emb|AJ311492.1|HSA311492 Homo sapiens polymorphic CD30 promoter of the anaplastic large cell lymphoma cell line SU-DHL1 Length = 1605 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 998 atccatccatccatccaccaa 1018
>emb|AJ311491.1|HSA311491 Homo sapiens polymorphic CD30 promoter of the anaplastic large cell lymphoma cell line DEL Length = 1596 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 989 atccatccatccatccaccaa 1009
>emb|AJ311490.1|HSA311490 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's lymphoma-derived cell line L428 Length = 1596 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 989 atccatccatccatccaccaa 1009
>emb|AJ311489.1|HSA311489 Homo sapiens polymorphic CD30 promoter from tonsillar tissue Length = 1329 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 722 atccatccatccatccaccaa 742
>emb|AJ311488.1|HSA311488 Homo sapiens polymorphic CD30 promoter from Hodgkin's lymphoma-derived cell line L1236 Length = 1177 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 570 atccatccatccatccaccaa 590
>emb|AJ311487.1|HSA311487 Homo sapiens polymorphic CD30 promoter from pancreatic tissue Length = 1173 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 566 atccatccatccatccaccaa 586
>emb|AJ308522.1|HSA308522 Homo sapiens partial CD30 gene, promoter region, isolate placenta No.1 Length = 1054 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 447 atccatccatccatccaccaa 467
>emb|AJ308521.1|HSA308521 Homo sapiens partial CD30 gene, promoter region, cell line Ho Length = 1050 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 443 atccatccatccatccaccaa 463
>emb|AJ272029.1|HSA272029 Homo sapiens partial CD30 gene for cytokine receptor CD30 and promoter region Length = 6518 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 2523 atccatccatccatccaccaa 2543
>emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102 Length = 340000 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 10653 atccatccatccatccaccaa 10673
>gb|AC151910.4| Mus musculus BAC clone RP23-67A17 from 14, complete sequence Length = 207254 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 46386 atccatccatccatccaccaa 46406
>emb|CR759910.13| Zebrafish DNA sequence from clone DKEYP-79C4 in linkage group 19, complete sequence Length = 217814 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 67993 atccatccatccatccaccaa 67973
>gb|AC154412.3| Mus musculus BAC clone RP24-225G4 from 14, complete sequence Length = 182048 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 34472 atccatccatccatccaccaccatc 34496
>emb|BX927293.15| Zebrafish DNA sequence from clone DKEY-95H12 in linkage group 18, complete sequence Length = 150229 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 139517 atccatccatccatccaccaa 139537
>emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in linkage group 20, complete sequence Length = 153083 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatc 102 |||||||||||||||||||| |||| Sbjct: 7224 atccatccatccatccaccatcatc 7248
>emb|BX649423.7| Zebrafish DNA sequence from clone DKEY-18O7 in linkage group 4, complete sequence Length = 182374 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 116230 atccatccatccatccaccaa 116250 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 115854 atccatccatccatccaccaa 115874 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacat 101 ||||||||||||||||||| |||| Sbjct: 28418 atccatccatccatccacctacat 28441
>gb|AE003491.4| Drosophila melanogaster chromosome X, section 43 of 74 of the complete sequence Length = 332030 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Minus Query: 175 caatttccgcttctgcttcttcttc 199 ||||||| ||||||||||||||||| Sbjct: 216865 caatttcagcttctgcttcttcttc 216841
>dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-176J24, complete sequences Length = 171744 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 143818 atccatccatccatccaccaa 143798
>gb|AC119183.8| Mus musculus chromosome 15, clone RP24-172H2, complete sequence Length = 144236 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 3444 atccatccatccatccaccaa 3424
>emb|AL837509.11| Mouse DNA sequence from clone RP23-44L6 on chromosome 2, complete sequence Length = 156698 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 74418 atccatccatccatccaccaa 74438
>gb|AC003693.1|AC003693 Human Chromosome 11p15.5 PAC clone pDJ915f1 containing KvLQT1 gene, complete sequence Length = 155074 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 50687 atccatccatccatccaccaa 50707
>emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chromosome 2, complete sequence Length = 181372 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 25432 atccatccatccatccaccaa 25452
>emb|BX322557.1|HS112E20 Homo sapiens chromosome 21 from PAC RP1-112E20 map 21q22.3 region D21S171-LA161, complete sequence Length = 124074 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 77870 atccatccatccatccaccaa 77890
>gb|AC140449.3| Mus musculus BAC clone RP24-116C1 from 9, complete sequence Length = 222299 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 174212 atccatccatccatccaccaa 174232 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 174188 atccatccatccatccaccaa 174208
>gb|AF058826.1|AF058826 Arabidopsis thaliana BAC T26D22 Length = 113567 Score = 42.1 bits (21), Expect = 0.94 Identities = 24/25 (96%) Strand = Plus / Minus Query: 174 tcaatttccgcttctgcttcttctt 198 ||||||||||||||| ||||||||| Sbjct: 57921 tcaatttccgcttcttcttcttctt 57897
>gb|AC140110.2| Mus musculus BAC clone RP23-29H6 from 6, complete sequence Length = 214089 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 10202 atccatccatccatccaccaa 10182
>gb|AC147230.3| Mus musculus BAC clone RP23-239N12 from 15, complete sequence Length = 255976 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 69152 atccatccatccatccaccaa 69132
>gb|AC145303.4| Mus musculus BAC clone RP23-411P20 from 14, complete sequence Length = 190168 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 31224 atccatccatccatccaccaa 31204
>emb|CT025537.7| Mouse DNA sequence from clone RP23-454O17 on chromosome 14, complete sequence Length = 192695 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 175296 atccatccatccatccaccaa 175316
>dbj|AP003071.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-554A11, complete sequence Length = 191898 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 31324 atccatccatccatccaccaa 31344 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 31232 atccatccatccatccaccaa 31252 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 31144 atccatccatccatccaccaa 31164
>emb|AJ289159.1|HSA289159 Homo sapiens CD30 gene for cytokine receptor CD30, exons 1-8 Length = 24538 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 2523 atccatccatccatccaccaa 2543
>gb|AC161768.25| Mus musculus 6 BAC RP23-37C14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 196068 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Minus Query: 46 ctacatataacatacagagtc 66 ||||||||||||||||||||| Sbjct: 149494 ctacatataacatacagagtc 149474 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 46 ctacatataacatacagagtc 66 ||||||||||||||||||||| Sbjct: 127347 ctacatataacatacagagtc 127367
>emb|AJ409012.1|HSA409012 Homo sapiens CD30 gene, promoter region, individual no.3 Length = 1345 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 738 atccatccatccatccaccaa 758
>emb|AJ409011.1|HSA409011 Homo sapiens CD30 gene, promoter region, individual no.2 Length = 1165 Score = 42.1 bits (21), Expect = 0.94 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaa 98 ||||||||||||||||||||| Sbjct: 558 atccatccatccatccaccaa 578
>gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome 9, complete sequence Length = 182190 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 117751 atccatccatccatccacca 117770
>gb|DQ223119.1| Alasmidonta heterodon microsatellite AheB121 sequence Length = 375 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 83 atccatccatccatccacca 64
>ref|NM_189851.1| Oryza sativa (japonica cultivar-group), mRNA Length = 228 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 151 gatccatccatccatccacc 132
>gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, complete sequence Length = 162139 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 11211 gatccatccatccatccacc 11192
>gb|AC104882.30| Mus musculus chromosome 8, clone RP23-401L9, complete sequence Length = 209525 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 tccatccatccatccaccaa 98 |||||||||||||||||||| Sbjct: 133582 tccatccatccatccaccaa 133563
>gb|AF377947.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, complete sequence Length = 137580 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 caggcacggatccatccatccatc 92 |||||||| ||||||||||||||| Sbjct: 135221 caggcacgcatccatccatccatc 135244
>gb|AC123993.10| Mus musculus chromosome 3, clone RP24-357L20, complete sequence Length = 187115 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 86283 atccatccatccatccacca 86264
>gb|AC118676.6| Mus musculus chromosome 7, clone RP24-178N18, complete sequence Length = 149930 Score = 40.1 bits (20), Expect = 3.7 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Minus Query: 78 atccatccatccatcca-ccaacatcta 104 ||||||||||||||||| |||||||||| Sbjct: 97827 atccatccatccatccatccaacatcta 97800
>gb|AY676260.1| Acropora palmata strain ApPRs2 clone f6 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, complete sequence Length = 705 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 74 acggatccatccatccatcc 93 |||||||||||||||||||| Sbjct: 138 acggatccatccatccatcc 157
>gb|AC118318.7| Rattus norvegicus 7 BAC CH230-15G17 (Children's Hospital Oakland Research Institute) complete sequence Length = 128601 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 117747 atccatccatccatccacca 117728
>gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, complete sequence Length = 213155 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 151934 atccatccatccatccacca 151915
>gb|AC137594.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBa0065A15, complete sequence Length = 168806 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 66693 gatccatccatccatccacc 66674
>gb|AC104709.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete sequence Length = 144601 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 41930 gatccatccatccatccacc 41949
>gb|AC068459.9| Mus musculus chromosome 12, clone RP23-158M23, complete sequence Length = 198494 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 146985 atccatccatccatccacca 146966
>gb|AC129576.11| Mus musculus chromosome 10, clone RP24-343D9, complete sequence Length = 136276 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 65557 atccatccatccatccacca 65576
>ref|XM_677451.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN9274.2), mRNA Length = 717 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 ccgcttctgcttcttcttcg 200 |||||||||||||||||||| Sbjct: 393 ccgcttctgcttcttcttcg 412
>gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome 7, complete sequence Length = 202934 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 185345 atccatccatccatccacca 185364
>gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosome 12, complete sequence Length = 172985 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 164732 atccatccatccatccacca 164751
>gb|AC145307.3| Mus musculus BAC clone RP24-400C6 from chromosome 17, complete sequence Length = 203180 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 149654 atccatccatccatccacca 149635
>gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, complete sequence Length = 194261 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 130434 atccatccatccatccacca 130415
>gb|AC113201.15| Mus musculus chromosome 6, clone RP23-271G7, complete sequence Length = 205816 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 48455 atccatccatccatccacca 48474
>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence Length = 234127 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 80568 atccatccatccatccacca 80549
>gb|AC158608.10| Mus musculus 10 BAC RP24-405N1 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 181588 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 20134 atccatccatccatccacca 20115
>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence Length = 236510 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 78 atccatccatccatccaccaacat 101 ||||||||||||||||||| |||| Sbjct: 61783 atccatccatccatccacccacat 61760
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 caggcacggatccatccatccatc 92 |||||||| ||||||||||||||| Sbjct: 30668457 caggcacgcatccatccatccatc 30668434
>gb|AC164086.3| Mus musculus BAC clone RP23-25E6 from chromosome 13, complete sequence Length = 214085 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 87082 atccatccatccatccacca 87101
>gb|AC164155.2| Mus musculus BAC clone RP24-548I6 from chromosome 14, complete sequence Length = 215419 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 202621 gatccatccatccatccacc 202640
>gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 264561 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 176848 atccatccatccatccacca 176829
>gb|AC127334.3| Mus musculus BAC clone RP23-137P16 from chromosome 3, complete sequence Length = 180760 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 64261 atccatccatccatccacca 64242
>gb|AC122541.3| Mus musculus BAC clone RP24-567D4 from chromosome 5, complete sequence Length = 166883 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 115545 atccatccatccatccacca 115526 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 25690 atccatccatccatccacca 25671
>gb|AC115743.10| Mus musculus chromosome 5, clone RP23-477P24, complete sequence Length = 189890 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 166206 atccatccatccatccacca 166187
>gb|AC117118.4| Rattus norvegicus 1 BAC CH230-161O8 (Children's Hospital Oakland Research Institute) complete sequence Length = 216036 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 101540 atccatccatccatccacca 101521
>gb|AC126250.4| Mus musculus BAC clone RP23-452K12 from chromosome 14, complete sequence Length = 194924 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 109417 gatccatccatccatccacc 109436
>gb|AC092556.8| Oryza sativa chromosome 3 BAC OSJNBa0047E24 genomic sequence, complete sequence Length = 157970 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 caggcacggatccatccatccatc 92 |||||||| ||||||||||||||| Sbjct: 93935 caggcacgcatccatccatccatc 93958
>gb|AC134832.5| Mus musculus BAC clone RP24-561D12 from chromosome 7, complete sequence Length = 158123 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 99119 atccatccatccatccacca 99138
>gb|AC144672.2| Mus musculus BAC clone RP23-287L2 from chromosome 18, complete sequence Length = 139404 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 65079 atccatccatccatccacca 65060
>emb|BX677675.9| Zebrafish DNA sequence from clone DKEYP-90G12 in linkage group 2, complete sequence Length = 124301 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 74272 atccatccatccatccacca 74253
>emb|BX511141.27| Zebrafish DNA sequence from clone DKEYP-10C6 in linkage group 23, complete sequence Length = 165253 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 152533 atccatccatccatccacca 152552
>emb|CR626875.10| Zebrafish DNA sequence from clone DKEY-31J4 in linkage group 15, complete sequence Length = 212742 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacat 101 ||||||||||||||||| |||||| Sbjct: 33396 atccatccatccatccaacaacat 33419
>emb|CR956635.11| Pig DNA sequence from clone CH242-184L20 on chromosome 17, complete sequence Length = 211741 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 121569 atccatccatccatccacca 121588
>emb|CR788319.8| Zebrafish DNA sequence from clone DKEY-245H10 in linkage group 12, complete sequence Length = 188205 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 99446 atccatccatccatccacca 99465
>emb|BX927327.14| Zebrafish DNA sequence from clone CH211-11C15 in linkage group 14, complete sequence Length = 182779 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 catccatccatccaccaaca 100 |||||||||||||||||||| Sbjct: 120456 catccatccatccaccaaca 120475
>emb|CR855305.12| Zebrafish DNA sequence from clone DKEY-98F17 in linkage group 5, complete sequence Length = 155542 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 126178 atccatccatccatccacca 126159
>ref|XM_446112.1| Candida glabrata CBS138, CAGL0F03267g partial mRNA Length = 3993 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 179 ttccgcttctgcttcttctt 198 |||||||||||||||||||| Sbjct: 53 ttccgcttctgcttcttctt 34
>gb|AC110524.11| Mus musculus chromosome 9, clone RP23-403L22, complete sequence Length = 225122 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 127993 atccatccatccatccacca 127974
>gb|AC110234.11| Mus musculus chromosome 5, clone RP23-76J15, complete sequence Length = 235276 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 179719 atccatccatccatccacca 179738
>gb|AC002394.1|HUAC002394 Human Chromosome 16 BAC clone CIT987SK-A-211C6, complete sequence Length = 107910 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 ggatccatccatccatccac 95 |||||||||||||||||||| Sbjct: 53290 ggatccatccatccatccac 53271
>gb|AC126672.3| Mus musculus BAC clone RP24-473A18 from chromosome 9, complete sequence Length = 191730 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 158661 atccatccatccatccacca 158680
>gb|AC103810.5| Homo sapiens chromosome 17, clone RP11-927P21, complete sequence Length = 203192 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 ccatccatccatccaccaac 99 |||||||||||||||||||| Sbjct: 148560 ccatccatccatccaccaac 148541
>gb|AC124438.4| Mus musculus BAC clone RP24-260K9 from chromosome 7, complete sequence Length = 183326 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 61654 atccatccatccatccacca 61673
>gb|AC127235.3| Mus musculus BAC clone RP24-570A23 from chromosome 10, complete sequence Length = 189180 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 39550 atccatccatccatccacca 39569
>emb|CR854834.11| Zebrafish DNA sequence from clone DKEYP-92B10 in linkage group 11, complete sequence Length = 140484 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 109471 atccatccatccatccacca 109452
>gb|AC125179.4| Mus musculus BAC clone RP23-321N8 from chromosome 16, complete sequence Length = 193474 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 133 gaattacagtttcttcgtct 152 |||||||||||||||||||| Sbjct: 156746 gaattacagtttcttcgtct 156765
>gb|AC123921.3| Mus musculus BAC clone RP24-180J14 from chromosome 8, complete sequence Length = 183936 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 123426 atccatccatccatccacca 123445 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 41204 atccatccatccatccacca 41223
>gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complete sequence Length = 235023 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 87288 atccatccatccatccacca 87307
>emb|CR555294.10| Zebrafish DNA sequence from clone CH211-169P4 in linkage group 19, complete sequence Length = 142042 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 80678 atccatccatccatccacca 80697 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 80323 atccatccatccatccacca 80342
>gb|AC112269.3| Mus musculus BAC clone RP24-115O19 from 2, complete sequence Length = 172714 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 135946 atccatccatccatccacca 135927
>gb|AC121578.2| Mus musculus BAC clone RP23-253I14 from 5, complete sequence Length = 125303 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 76357 atccatccatccatccacca 76338 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 76261 atccatccatccatccacca 76242
>emb|CR693293.2|CNS0FXW9 Tetraodon nigroviridis full-length cDNA Length = 876 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 806 gatccatccatccatccacc 825
>gb|AC006337.5| Homo sapiens BAC clone RP11-535N23 from 7, complete sequence Length = 172291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 tccatccatccatccaccaa 98 |||||||||||||||||||| Sbjct: 142715 tccatccatccatccaccaa 142734
>gb|AC113287.8| Mus musculus chromosome 3, clone RP23-412L13, complete sequence Length = 214444 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 49532 gatccatccatccatccacc 49551
>gb|AC016522.10| Mus musculus chromosome 7, clone RP23-352D23, complete sequence Length = 191935 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 189076 gatccatccatccatccacc 189057
>emb|CR847799.17| Zebrafish DNA sequence from clone DKEY-117P4 in linkage group 8, complete sequence Length = 128900 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 82913 atccatccatccatccacca 82932
>gb|AC159474.9| Mus musculus 10 BAC RP23-28P17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 230201 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 95996 atccatccatccatccacca 95977
>gb|AC159466.3| Mus musculus 10 BAC RP23-388A21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190140 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 68965 atccatccatccatccacca 68946
>emb|CR936470.3| Human DNA sequence from clone XX-C455C658L on chromosome 22, complete sequence Length = 7143 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 6627 atccatccatccatccacca 6646
>emb|BX855598.22| Zebrafish DNA sequence from clone DKEY-52J13 in linkage group 13, complete sequence Length = 209449 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 94799 atccatccatccatccacca 94780
>emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chromosome 10 Contains the ALOX5 gene for arachidonate 5-lipoxygenase, a novel gene, the 3' end of a gene for cellular modulator of immune recognition (c-MIR) and five CpG islands, complete sequence Length = 129266 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 77127 atccatccatccatccacca 77108
>emb|AL672311.26| Human DNA sequence from clone RP13-167H21 on chromosome X, complete sequence Length = 115998 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 84246 atccatccatccatccacca 84227
>emb|AL683826.14| Human DNA sequence from clone XXyac-21CG7 on chromosome 10 Contains gene FLJ21665, the gene for stresscopin (SPC) (SCP UCN3 UCNIII) and the 5' end of a ribosomal protein L26 (RPL26) pseudogene, complete sequence Length = 103752 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 31017 atccatccatccatccacca 30998
>emb|AL593848.14| Human DNA sequence from clone RP13-100B2 on chromosome 9 Contains the 3' end of the ADAMTS13 gene for a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif 13, the C9orf7 gene for chromosome 9 open reading frame 7, the SLC2A6 gene for solute carrier family 2 (facilitated glucose transporter) member 6, a novel gene and two CpG islands, complete sequence Length = 53335 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 50206 atccatccatccatccacca 50187
>emb|AL591890.31| Human DNA sequence from clone RP11-54A22 on chromosome 9 Contains three novel genes, and the 5' end of the COL5A1 gene for collagen (type V) alpha 1, and a CpG island, complete sequence Length = 173415 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 127548 atccatccatccatccacca 127567 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 125886 atccatccatccatccacca 125905 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 125800 atccatccatccatccacca 125819 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 125580 atccatccatccatccacca 125599 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 125340 atccatccatccatccacca 125359 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 125262 atccatccatccatccacca 125281
>emb|AL596210.20| Human DNA sequence from clone RP11-92O17 on chromosome 1 Contains part of the CAMTA1 gene for calmodulin binding transcription activator 1, complete sequence Length = 107112 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 53669 atccatccatccatccacca 53650
>emb|AL590551.7| Human DNA sequence from clone RP11-243O10 on chromosome 6 Contains part of a novel gene (FNDC2), the 3' end of the FNDC1 gene for fibronectin type III domain containing 1, a novel gene and a CpG island, complete sequence Length = 106861 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacatctag 105 ||||||||||||||||||| || ||||| Sbjct: 38140 atccatccatccatccacccacctctag 38167
>emb|AL445931.29| Human DNA sequence from clone RP11-374P20 on chromosome 9 Contains the 5' end of the VAV2 gene for vav 2 oncogene, a novel gene (FLJ35348), the 3' end of the BRD3 gene for bromodomain containing 3, a novel gene and five CpG islands, complete sequence Length = 175033 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 46781 atccatccatccatccacca 46762
>emb|AL392109.8| Human DNA sequence from clone RP13-459H7 on chromosome 10, complete sequence Length = 101319 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 30731 atccatccatccatccacca 30712
>gb|AC139034.7| Mus musculus chromosome 6, clone RP23-350J11, complete sequence Length = 247394 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 214661 atccatccatccatccacca 214680
>emb|AL356282.13| Human DNA sequence from clone RP11-303E19 on chromosome 9 Contains part of the GPR51 gene for G protein-coupled receptor 51 (HG20, GABBR2, GPRC3B, GABABR2), complete sequence Length = 48103 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 atccatccatccatccaccaacat 101 ||||||||||||||||||| |||| Sbjct: 43424 atccatccatccatccacctacat 43447
>emb|AL353615.37| Human DNA sequence from clone RP11-555H7 on chromosome 9 Contains a gene for a novel protein (MGC35463), complete sequence Length = 107891 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 95278 atccatccatccatccacca 95259
>emb|AL353593.33| Human DNA sequence from clone RP5-1139B12 on chromosome 1q42.1-43 Contains part of the OBSCN gene for obscurin cytoskeletal calmodulin and titin-interacting RhoGEF protein and four CpG islands, complete sequence Length = 135964 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 106897 atccatccatccatccacca 106916
>gb|AC098563.6| Rattus norvegicus 1 BAC CH230-123A15 (Children's Hospital Oakland Research Institute) complete sequence Length = 250414 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 71665 atccatccatccatccacca 71684
>emb|AL136379.19| Human DNA sequence from clone RP5-881P19 on chromosome 1q42.11-42.3 Contains the WNT3A gene for wingless-type MMTV integration site family member 3A protein, a novel protein, the ARF1 gene for ADP-ribosylation factor 1 protein, a C1orf35 gene for chromosome 1 open reading frame 35, the MRPL55 gene for mitochondrial ribosomal protein L55, a novel processed pseudogene and six CpG islands, complete sequence Length = 127816 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 79500 atccatccatccatccacca 79481 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 79392 atccatccatccatccacca 79373
>emb|AL117380.28|HSJ749H19 Human DNA sequence from clone RP4-749H19 on chromosome 20q13.11-13.33 Contains ESTs, STSs, GSSs and a CpG island, complete sequence Length = 178473 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 150664 atccatccatccatccacca 150645
>emb|AL121910.26|HSDJ827L5 Human DNA sequence from clone RP5-827L5 on chromosome 20 Contains two putative novel genes, a CpG island, ESTs, STSs and GSSs, complete sequence Length = 141895 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 95107 atccatccatccatccacca 95126
>emb|AL121929.17|HSBA416N2 Human DNA sequence from clone RP11-416N2 on chromosome 10 Contains the 3' end of the NEURL gene for neuralized-like (Drosophila), the 3' end of the SH3MD1 gene for SH3 multiple domains 1 and seven CpG islands, complete sequence Length = 203262 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 175616 atccatccatccatccacca 175635 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 175068 atccatccatccatccacca 175087 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 174898 atccatccatccatccacca 174917 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 174762 atccatccatccatccacca 174781 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 174690 atccatccatccatccacca 174709
>emb|AL121908.16|HSDJ719C8 Human DNA sequence from clone RP4-719C8 on chromosome 20 Contains three different 5' ends of the C20orf101 gene and three CpG islands, complete sequence Length = 150985 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 63235 atccatccatccatccacca 63216
>emb|AL109811.40|HSJ635E18 Human DNA sequence from clone RP4-635E18 on chromosome 1p36.11-36.31 Contains the TARDBP gene for TAR DNA binding protein, the MASP2 gene for mannan-binding lectin serine protease 2, the SRM gene for spermidine synthase, the PMSCL2 gene for 100kDa polymyositis/scleroderma autoantigen 2 (FLJ41371, FLJ36636, two novel genes (FLJ30609), the 3' end of the FRAP1 gene for FK506 binding protein 12-rapamycin associated protein 1 and a CpG island, complete sequence Length = 112769 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 37964 atccatccatccatccacca 37945 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 35695 atccatccatccatccacca 35676
>emb|AL050325.20|HSJ824F16 Human DNA sequence from clone RP5-824F16 on chromosome 20 Contains the 5' end of the ANGPT4 gene for angiopoietin 4, part of the gene for a novel protein similar to mouse thrombospondin type 1 domain protein R-spondin and a CpG island, complete sequence Length = 139330 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 ccatccatccatccaccaac 99 |||||||||||||||||||| Sbjct: 89814 ccatccatccatccaccaac 89833
>emb|AL050402.16|HSBA46E17 Human DNA sequence from clone RP11-46E17 on chromosome 22, complete sequence Length = 109710 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 62221 atccatccatccatccacca 62240
>emb|AL096766.12|HSDA59H18 Human DNA sequence from clone RP6-59H18 on chromosome 22, complete sequence Length = 70890 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 100 gatccatccatccatccacc 81
>emb|AL049540.11|HSJ890O15 Human DNA sequence from clone RP5-890O15 on chromosome 20, complete sequence Length = 74549 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 31332 atccatccatccatccacca 31313
>emb|AL050324.5|HSJ822J19 Human DNA sequence from clone RP5-822J19 on chromosome 20 Contains a cyclic AMP phosphoprotein (ARPP-19) pseudogene, complete sequence Length = 89872 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 64554 atccatccatccatccacca 64535
>emb|AL022316.2|HS126B4 Human DNA sequence from clone CTA-126B4 on chromosome 22q13.2-13.31, complete sequence Length = 156212 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 100501 atccatccatccatccacca 100520
>emb|AL021392.5|HS439F8 Human DNA sequence from clone RP3-439F8 on chromosome 22q13.31-33, complete sequence Length = 120206 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 1 gatccatccatccatccacc 20
>emb|AL008636.1|HS722E9 Human DNA sequence from clone CTA-722E9 on chromosome 22q13.2-13.33, complete sequence Length = 81674 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 57542 atccatccatccatccacca 57561 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 57496 atccatccatccatccacca 57515 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 57226 atccatccatccatccacca 57245 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 57177 atccatccatccatccacca 57196 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 56956 atccatccatccatccacca 56975 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 56929 atccatccatccatccacca 56948 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 56778 atccatccatccatccacca 56797 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 56740 atccatccatccatccacca 56759 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 56641 atccatccatccatccacca 56660 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 56618 atccatccatccatccacca 56637 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 56595 atccatccatccatccacca 56614 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 56572 atccatccatccatccacca 56591
>emb|CR450789.9| Zebrafish DNA sequence from clone DKEY-7P12 in linkage group 8, complete sequence Length = 144569 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 61549 atccatccatccatccacca 61530
>gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, complete sequence Length = 178651 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 170479 atccatccatccatccacca 170498
>gb|AC164097.2| Mus musculus BAC clone RP23-141F18 from chromosome 16, complete sequence Length = 217725 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 133 gaattacagtttcttcgtct 152 |||||||||||||||||||| Sbjct: 17766 gaattacagtttcttcgtct 17785
>emb|CR380952.1| Candida glabrata strain CBS138 chromosome F complete sequence Length = 927101 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 ttccgcttctgcttcttctt 198 |||||||||||||||||||| Sbjct: 325749 ttccgcttctgcttcttctt 325768
>gb|AC160970.7| Mus musculus BAC clone RP24-492D11 from chromosome 10, complete sequence Length = 205283 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 169387 atccatccatccatccacca 169406
>gb|AC163342.2| Mus musculus BAC clone RP24-115M13 from chromosome 9, complete sequence Length = 204620 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 11107 atccatccatccatccacca 11126
>emb|BX119920.7| Zebrafish DNA sequence from clone CH211-46O21 in linkage group 15, complete sequence Length = 123713 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 77 gatccatccatccatccaccaaca 100 |||||||||||||||||| ||||| Sbjct: 58115 gatccatccatccatccagcaaca 58138
>emb|AL596122.14| Mouse DNA sequence from clone RP23-320E6 on chromosome 11 Contains the Taf15 gene for TAF15 RNA polymerase II TATA box binding protein (TBP)-associated factor, two novel genes, the Ccl5, Ccl9, Ccl6, Ccl3 and Ccl4 genes for chemokine (C-C motif) ligand 5, 9, 6, 3 and 4, a ribosomal protein L9 (Rpl9) pseudogene, three extracellular proteinase inhibitor (Expi) pseudogene and an H+ transporting mitochondrial F1F0 complex ATP synthase subunit e (Atp5k) pseudogene,, complete sequence Length = 211873 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 123085 atccatccatccatccacca 123104
>emb|AJ314906.1|HSA314906 Homo sapiens partial OBSCN gene for obscurin, exons 57-68 Length = 18760 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 3010 atccatccatccatccacca 3029
>gb|AC154233.3| Mus musculus BAC clone RP24-345G9 from chromosome 16, complete sequence Length = 178248 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 69484 atccatccatccatccacca 69503
>gb|AC139749.4| Homo sapiens chromosome 11, clone RP13-870H17, complete sequence Length = 131676 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 44148 atccatccatccatccacca 44129 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 44011 atccatccatccatccacca 43992 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 43965 atccatccatccatccacca 43946 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 43782 atccatccatccatccacca 43763 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 43716 atccatccatccatccacca 43697
>emb|CR407560.11| Zebrafish DNA sequence from clone CH211-180L14, complete sequence Length = 127482 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 117009 atccatccatccatccacca 117028
>gb|AC090013.16| Homo sapiens 12 BAC RP11-407P2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 85446 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 74703 atccatccatccatccacca 74684
>gb|AC007834.40| Homo sapiens 12 BAC RP11-7G5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 210578 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 gatccatccatccatccacc 96 |||||||||||||||||||| Sbjct: 90481 gatccatccatccatccacc 90462
>gb|AC156982.8| Mus musculus chromosome 19, clone RP23-183N3, complete sequence Length = 216311 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 170372 atccatccatccatccacca 170353
>emb|BX510929.10| Zebrafish DNA sequence from clone CH211-261F9, complete sequence Length = 156428 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 148198 atccatccatccatccacca 148217
>emb|AL929349.10| Zebrafish DNA sequence from clone CH211-207D24 in linkage group 20 Contains eight CpG islands, complete sequence Length = 196371 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atccatccatccatccacca 97 |||||||||||||||||||| Sbjct: 122578 atccatccatccatccacca 122597 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,942,105 Number of Sequences: 3902068 Number of extensions: 2942105 Number of successful extensions: 322858 Number of sequences better than 10.0: 399 Number of HSP's better than 10.0 without gapping: 399 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 307241 Number of HSP's gapped (non-prelim): 15575 length of query: 284 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 262 effective length of database: 17,147,199,772 effective search space: 4492566340264 effective search space used: 4492566340264 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
