ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl54b10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 38 1.7
2gb|AC161268.5| Mus musculus BAC clone RP23-198F11 from chromosom... 38 1.7
3gb|AC160987.4| Mus musculus BAC clone RP23-248O24 from chromosom... 38 1.7
4gb|AC124392.6| Mus musculus BAC clone RP24-441F24 from chromosom... 38 1.7
5gb|AC158192.2| Selaginella moellendorffii clone JGIASXY-5N4, com... 38 1.7
6gb|AC122346.4| Mus musculus BAC clone RP23-368L6 from 13, comple... 38 1.7
7ref|XM_761929.1| Giardia lamblia ATCC 50803 hypothetical protein... 36 6.9
8ref|XM_948220.1| Theileria annulata strain Ankara hypothetical p... 36 6.9
9emb|AL353148.8| Human DNA sequence from clone RP11-298H24 on chr... 36 6.9
10emb|AL049698.3|HSJ470B24 Human DNA sequence from clone RP3-470B2... 36 6.9
11gb|AC124971.15| Medicago truncatula clone mth2-22h8, complete se... 36 6.9
12gb|AC010867.8| Homo sapiens chromosome 15 clone RP11-390M11 map ... 36 6.9
13gb|AC174480.1| Mus musculus BAC clone RP23-154N2 from chromosome... 36 6.9
14gb|AC171813.2| Mus musculus BAC clone RP23-75G11 from chromosome... 36 6.9
15dbj|AB016897.1| Homo sapiens genomic DNA, chromosome 6q27, compl... 36 6.9
16dbj|AB011399.1| Homo sapiens gene for AF-6, complete cds 36 6.9

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
               sequence
          Length = 2300533

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 26      cctgatcatacacatcctt 44
               |||||||||||||||||||
Sbjct: 1224880 cctgatcatacacatcctt 1224898



to top

>gb|AC161268.5| Mus musculus BAC clone RP23-198F11 from chromosome 16, complete sequence
          Length = 212995

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 24     cccctgatcatacacatccttgt 46
              |||||| ||||||||||||||||
Sbjct: 200987 cccctggtcatacacatccttgt 201009



to top

>gb|AC160987.4| Mus musculus BAC clone RP23-248O24 from chromosome 16, complete sequence
          Length = 202729

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 24     cccctgatcatacacatccttgt 46
              |||||| ||||||||||||||||
Sbjct: 108818 cccctggtcatacacatccttgt 108796



to top

>gb|AC124392.6| Mus musculus BAC clone RP24-441F24 from chromosome 13, complete sequence
          Length = 159514

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      acaaaaaatatagctaggc 24
              |||||||||||||||||||
Sbjct: 149171 acaaaaaatatagctaggc 149153



to top

>gb|AC158192.2| Selaginella moellendorffii clone JGIASXY-5N4, complete sequence
          Length = 37184

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 29    gatcatacacatccttgtctaca 51
             ||||| |||||||||||||||||
Sbjct: 20178 gatcaaacacatccttgtctaca 20200



to top

>gb|AC122346.4| Mus musculus BAC clone RP23-368L6 from 13, complete sequence
          Length = 198130

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     acaaaaaatatagctaggc 24
             |||||||||||||||||||
Sbjct: 57015 acaaaaaatatagctaggc 56997



to top

>ref|XM_761929.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_89_14753_16624)
            partial mRNA
          Length = 1872

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 31   tcatacacatccttgtct 48
            ||||||||||||||||||
Sbjct: 1328 tcatacacatccttgtct 1311



to top

>ref|XM_948220.1| Theileria annulata strain Ankara hypothetical protein (TA10575)
           partial mRNA
          Length = 306

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 29  gatcatacacatccttgt 46
           ||||||||||||||||||
Sbjct: 241 gatcatacacatccttgt 224



to top

>emb|AL353148.8| Human DNA sequence from clone RP11-298H24 on chromosome 10 Contains a
             novel gene, complete sequence
          Length = 181308

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 29    gatcatacacatccttgtctac 50
             ||||||||| ||||||||||||
Sbjct: 76312 gatcatacatatccttgtctac 76333



to top

>emb|AL049698.3|HSJ470B24 Human DNA sequence from clone RP3-470B24 on chromosome 6q26-27 Contains
             the 3' end of a novel gene and the 3' end of the MLLT4
             gene for myeloid/lymphoid or mixed-lineage leukemia
             (trithorax (Drosophila) homolog) translocated gene protein
             4 (AF-6), complete sequence
          Length = 87780

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 15    atagctaggcccctgatc 32
             ||||||||||||||||||
Sbjct: 26074 atagctaggcccctgatc 26057



to top

>gb|AC124971.15| Medicago truncatula clone mth2-22h8, complete sequence
          Length = 122754

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    atatagctaggcccctga 30
             ||||||||||||||||||
Sbjct: 72592 atatagctaggcccctga 72609



to top

>gb|AC010867.8| Homo sapiens chromosome 15 clone RP11-390M11 map 15q21.3, complete
              sequence
          Length = 221631

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 8      aaaaaatatagctaggcc 25
              ||||||||||||||||||
Sbjct: 183920 aaaaaatatagctaggcc 183903



to top

>gb|AC174480.1| Mus musculus BAC clone RP23-154N2 from chromosome 1, complete sequence
          Length = 207205

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 14     tatagctaggcccctgat 31
              ||||||||||||||||||
Sbjct: 143160 tatagctaggcccctgat 143143



to top

>gb|AC171813.2| Mus musculus BAC clone RP23-75G11 from chromosome 1, complete sequence
          Length = 229986

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    tatagctaggcccctgat 31
             ||||||||||||||||||
Sbjct: 57455 tatagctaggcccctgat 57438



to top

>dbj|AB016897.1| Homo sapiens genomic DNA, chromosome 6q27, complete sequence
          Length = 331211

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 15     atagctaggcccctgatc 32
              ||||||||||||||||||
Sbjct: 257353 atagctaggcccctgatc 257370



to top

>dbj|AB011399.1| Homo sapiens gene for AF-6, complete cds
          Length = 163974

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 15     atagctaggcccctgatc 32
              ||||||||||||||||||
Sbjct: 126924 atagctaggcccctgatc 126941


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 516,187
Number of Sequences: 3902068
Number of extensions: 516187
Number of successful extensions: 130402
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 130354
Number of HSP's gapped (non-prelim): 48
length of query: 51
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 31
effective length of database: 17,155,003,908
effective search space: 531805121148
effective search space used: 531805121148
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top