ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl53h12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT009533.1| Triticum aestivum clone wr1.pk0133.f5:fis, full insert mRNA sequence Length = 1820 Score = 127 bits (64), Expect = 2e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 51 ttacaatcctttacagacgagaagggcgacagttttacaccaggcacttgcctccctgta 110 |||||||||||||||| ||| |||||||||||||| ||||| ||||||||||||||||| Sbjct: 1305 ttacaatcctttacaggcgaaaagggcgacagtttcacaccgagcacttgcctccctgta 1246 Query: 111 atgctagtctagcacaatggcgagccgc 138 |||||||||||||||||||| ||||||| Sbjct: 1245 atgctagtctagcacaatggtgagccgc 1218 Score = 44.1 bits (22), Expect = 0.22 Identities = 28/30 (93%) Strand = Plus / Minus Query: 1 gaaacagggcggcataactttattagcaat 30 ||||||| ||||||| |||||||||||||| Sbjct: 1369 gaaacagtgcggcatcactttattagcaat 1340 Score = 40.1 bits (20), Expect = 3.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 151 cacctgcgatctcaaattattctgtagg 178 |||||||||||| |||||||| |||||| Sbjct: 1218 cacctgcgatctgaaattattttgtagg 1191
>gb|AC110907.7| Mus musculus chromosome 7, clone RP24-180J10, complete sequence Length = 179750 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 29 atgttgttattgtttataacagtt 52 ||||||||||||||||||| |||| Sbjct: 30924 atgttgttattgtttataatagtt 30947
>emb|CR847570.9| Zebrafish DNA sequence from clone DKEY-29M9 in linkage group 3, complete sequence Length = 124104 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 30 tgttgttattgtttataaca 49 |||||||||||||||||||| Sbjct: 74620 tgttgttattgtttataaca 74639
>gb|AC136740.10| Mus musculus chromosome 7, clone RP23-137A24, complete sequence Length = 219863 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 29 atgttgttattgtttataacagtt 52 ||||||||||||||||||| |||| Sbjct: 193770 atgttgttattgtttataatagtt 193793
>emb|AL450163.12| Human DNA sequence from clone RP11-384L19 on chromosome 1 Contains part of the gene for C-terminal PDZ domain ligand of neuronal nitric oxide synthase (CAPON), complete sequence Length = 208408 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 tgttgttattgtttataacagtta 53 |||||||||||||||||| ||||| Sbjct: 15349 tgttgttattgtttataatagtta 15326
>emb|BX769175.12| Zebrafish DNA sequence from clone DKEY-229K5 in linkage group 3, complete sequence Length = 154794 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 30 tgttgttattgtttataaca 49 |||||||||||||||||||| Sbjct: 44123 tgttgttattgtttataaca 44142
>dbj|AK155714.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F730208F19 product:unclassifiable, full insert sequence Length = 1016 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 atgttgttattgtttataacagtt 52 ||||||||||||||||||| |||| Sbjct: 715 atgttgttattgtttataatagtt 692
>gb|AC090666.6| Homo sapiens chromosome 18, clone RP11-116K4, complete sequence Length = 185255 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 atgttgttattgtttataac 48 |||||||||||||||||||| Sbjct: 85341 atgttgttattgtttataac 85360
>gb|AC113278.15| Mus musculus chromosome 3, clone RP23-387I7, complete sequence Length = 180681 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 aatgttgttattgtttataa 47 |||||||||||||||||||| Sbjct: 56618 aatgttgttattgtttataa 56599
>emb|AL935192.10| Zebrafish DNA sequence from clone CH211-252B2, complete sequence Length = 192649 Score = 40.1 bits (20), Expect = 3.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 30 tgttgttattgtttataaca 49 |||||||||||||||||||| Sbjct: 81192 tgttgttattgtttataaca 81211 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,796,347 Number of Sequences: 3902068 Number of extensions: 1796347 Number of successful extensions: 41505 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 41488 Number of HSP's gapped (non-prelim): 17 length of query: 263 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 241 effective length of database: 17,147,199,772 effective search space: 4132475145052 effective search space used: 4132475145052 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
