ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl53g07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC009276.9|AC009276 Homo sapiens chromosome 7 clone RP11-239G... 50 0.005
2emb|CR381596.11| Zebrafish DNA sequence from clone DKEY-230M3 in... 46 0.084
3gb|AC083874.2|AC083874 Homo sapiens chromosome 7 clone RP11-792L... 44 0.33
4gb|AC068501.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 1.3
5emb|CR855858.5| Zebrafish DNA sequence from clone CH211-113H5 in... 42 1.3
6gb|AC149472.23| Medicago truncatula clone mth2-77f21, complete s... 42 1.3
7gb|DQ354455.1| Lemur catta breast and ovarian cancer susceptibil... 42 1.3
8gb|AC021739.16| Homo sapiens chromosome 15, clone RP11-158M2, co... 42 1.3
9gb|AC104229.18| Homo sapiens chromosome 15, clone RP11-23A22, co... 42 1.3
10gb|AC122542.3| Mus musculus BAC clone RP24-572J16 from 9, comple... 42 1.3
11gb|AY835586.1| Homo sapiens calpain 2, (m/II) large subunit (CAP... 40 5.2
12gb|AC125275.8| Mus musculus chromosome 7, clone RP24-165E9, comp... 40 5.2
13gb|AC125146.3| Mus musculus BAC clone RP24-348B1 from chromosome... 40 5.2
14gb|AC133889.9| Mus musculus chromosome 16, clone RP23-380I13, co... 40 5.2
15ref|XM_649962.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 40 5.2
16gb|AC139935.5| Mus musculus chromosome 16, clone RP23-383M10, co... 40 5.2
17gb|AC101879.8| Mus musculus chromosome 7, clone RP23-378H21, com... 40 5.2
18gb|AC099065.2| Homo sapiens chromosome 1 clone RP11-105I12, comp... 40 5.2
19gb|AC099567.2| Homo sapiens chromosome 1 clone RP5-936J12, compl... 40 5.2
20dbj|AK056838.1| Homo sapiens cDNA FLJ32276 fis, clone PROST20001... 40 5.2
21gb|AC096542.2| Homo sapiens chromosome 1 clone RP11-332L18, comp... 40 5.2
22gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, part... 40 5.2
23dbj|BS000021.1| Pan troglodytes chromosome 22 clone:PTB-141K15, ... 40 5.2
24emb|AL163210.2|HS21C010 Homo sapiens chromosome 21 segment HS21C010 40 5.2
25emb|AL953900.7| Mouse DNA sequence from clone RP24-166A20 on chr... 40 5.2
26emb|AJ010598.1|HS135E14 Homo sapiens chromosome 21 PAC RPCIP704E... 40 5.2

>gb|AC009276.9|AC009276 Homo sapiens chromosome 7 clone RP11-239G19, complete sequence
          Length = 163631

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 26    tgactaatgaaggagaaacaaaagg 50
             |||||||||||||||||||||||||
Sbjct: 90590 tgactaatgaaggagaaacaaaagg 90614



to top

>emb|CR381596.11| Zebrafish DNA sequence from clone DKEY-230M3 in linkage group 3, complete
              sequence
          Length = 157536

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 29     ctaatgaaggagaaacaaaaggt 51
              |||||||||||||||||||||||
Sbjct: 137861 ctaatgaaggagaaacaaaaggt 137883



to top

>gb|AC083874.2|AC083874 Homo sapiens chromosome 7 clone RP11-792L21, complete sequence
          Length = 186281

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 26    tgactaatgaaggagaaacaaa 47
             ||||||||||||||||||||||
Sbjct: 21775 tgactaatgaaggagaaacaaa 21796



to top

>gb|AC068501.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-23C4, complete
              sequence
          Length = 196175

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 364    tatgtcagtctacagtactgt 384
              |||||||||||||||||||||
Sbjct: 172169 tatgtcagtctacagtactgt 172149



to top

>emb|CR855858.5| Zebrafish DNA sequence from clone CH211-113H5 in linkage group 24,
             complete sequence
          Length = 152666

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 97    atttgttgcacatttttgcag 117
             |||||||||||||||||||||
Sbjct: 69812 atttgttgcacatttttgcag 69832



to top

>gb|AC149472.23| Medicago truncatula clone mth2-77f21, complete sequence
          Length = 120151

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 231   ctcctttggtgttggcaatga 251
             |||||||||||||||||||||
Sbjct: 87050 ctcctttggtgttggcaatga 87070



to top

>gb|DQ354455.1| Lemur catta breast and ovarian cancer susceptibility 1 (BRCA1)
           gene, partial cds
          Length = 2782

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 40  gaaacaaaaggtaattatgtt 60
           |||||||||||||||||||||
Sbjct: 851 gaaacaaaaggtaattatgtt 871



to top

>gb|AC021739.16| Homo sapiens chromosome 15, clone RP11-158M2, complete sequence
          Length = 112393

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 186    agaatcctcttcaccagtaag 206
              |||||||||||||||||||||
Sbjct: 104712 agaatcctcttcaccagtaag 104692



to top

>gb|AC104229.18| Homo sapiens chromosome 15, clone RP11-23A22, complete sequence
          Length = 168235

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  agaatcctcttcaccagtaag 206
            |||||||||||||||||||||
Sbjct: 1641 agaatcctcttcaccagtaag 1621



to top

>gb|AC122542.3| Mus musculus BAC clone RP24-572J16 from 9, complete sequence
          Length = 175952

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   tgatctcctttggtgttggca 247
             |||||||||||||||||||||
Sbjct: 92566 tgatctcctttggtgttggca 92546



to top

>gb|AY835586.1| Homo sapiens calpain 2, (m/II) large subunit (CAPN2) gene, complete cds
          Length = 66744

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   caaacacatgccaccaacag 137
             ||||||||||||||||||||
Sbjct: 60658 caaacacatgccaccaacag 60677



to top

>gb|AC125275.8| Mus musculus chromosome 7, clone RP24-165E9, complete sequence
          Length = 218429

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 334   ggcaatgtacagatggagag 353
             ||||||||||||||||||||
Sbjct: 91283 ggcaatgtacagatggagag 91302



to top

>gb|AC125146.3| Mus musculus BAC clone RP24-348B1 from chromosome 2, complete sequence
          Length = 212563

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 56    atgttatttccatcaaccaataaa 79
             ||||||||||||||||| ||||||
Sbjct: 46167 atgttatttccatcaacaaataaa 46144



to top

>gb|AC133889.9| Mus musculus chromosome 16, clone RP23-380I13, complete sequence
          Length = 235574

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     aaccaacattggtattgact 30
              ||||||||||||||||||||
Sbjct: 191248 aaccaacattggtattgact 191229



to top

>ref|XM_649962.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (37.t00023)
            partial mRNA
          Length = 2817

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 30   taatgaaggagaaacaaaag 49
            ||||||||||||||||||||
Sbjct: 2037 taatgaaggagaaacaaaag 2056



to top

>gb|AC139935.5| Mus musculus chromosome 16, clone RP23-383M10, complete sequence
          Length = 226328

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 11     aaccaacattggtattgact 30
              ||||||||||||||||||||
Sbjct: 202340 aaccaacattggtattgact 202359



to top

>gb|AC101879.8| Mus musculus chromosome 7, clone RP23-378H21, complete sequence
          Length = 174481

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 334   ggcaatgtacagatggagag 353
             ||||||||||||||||||||
Sbjct: 43556 ggcaatgtacagatggagag 43537



to top

>gb|AC099065.2| Homo sapiens chromosome 1 clone RP11-105I12, complete sequence
          Length = 181253

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 118    caaacacatgccaccaacag 137
              ||||||||||||||||||||
Sbjct: 135155 caaacacatgccaccaacag 135174



to top

>gb|AC099567.2| Homo sapiens chromosome 1 clone RP5-936J12, complete sequence
          Length = 171400

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    atgaaggagaaacaaaaggt 51
             ||||||||||||||||||||
Sbjct: 84799 atgaaggagaaacaaaaggt 84818



to top

>dbj|AK056838.1| Homo sapiens cDNA FLJ32276 fis, clone PROST2000105, moderately
           similar to CALPAIN 2, LARGE [CATALYTIC] SUBUNIT (EC
           3.4.22.17)
          Length = 2373

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 118 caaacacatgccaccaacag 137
           ||||||||||||||||||||
Sbjct: 598 caaacacatgccaccaacag 617



to top

>gb|AC096542.2| Homo sapiens chromosome 1 clone RP11-332L18, complete sequence
          Length = 189411

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   caaacacatgccaccaacag 137
             ||||||||||||||||||||
Sbjct: 23703 caaacacatgccaccaacag 23722



to top

>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 235    tttggtgttggcaatgatca 254
              ||||||||||||||||||||
Sbjct: 157676 tttggtgttggcaatgatca 157695



to top

>dbj|BS000021.1| Pan troglodytes chromosome 22 clone:PTB-141K15, map 22, complete
             sequences
          Length = 183533

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 207   tttgaacacctagatgatgatgat 230
             |||||||| |||||||||||||||
Sbjct: 72532 tttgaacaactagatgatgatgat 72509



to top

>emb|AL163210.2|HS21C010 Homo sapiens chromosome 21 segment HS21C010
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 207    tttgaacacctagatgatgatgat 230
              |||||||| |||||||||||||||
Sbjct: 141805 tttgaacaactagatgatgatgat 141782



to top

>emb|AL953900.7| Mouse DNA sequence from clone RP24-166A20 on chromosome 2, complete
             sequence
          Length = 131582

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 56    atgttatttccatcaaccaataaa 79
             ||||||||||||||||| ||||||
Sbjct: 79719 atgttatttccatcaacaaataaa 79742



to top

>emb|AJ010598.1|HS135E14 Homo sapiens chromosome 21 PAC RPCIP704E14135Q2, complete sequence
          Length = 135855

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 207   tttgaacacctagatgatgatgat 230
             |||||||| |||||||||||||||
Sbjct: 12471 tttgaacaactagatgatgatgat 12448


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,910,404
Number of Sequences: 3902068
Number of extensions: 3910404
Number of successful extensions: 73017
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72970
Number of HSP's gapped (non-prelim): 47
length of query: 389
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 367
effective length of database: 17,147,199,772
effective search space: 6293022316324
effective search space used: 6293022316324
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top