ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl53g06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY107171.1| Zea mays PCO069619 mRNA sequence Length = 1102 Score = 149 bits (75), Expect = 7e-33 Identities = 114/127 (89%) Strand = Plus / Minus Query: 207 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 266 |||||||||||||||||||||||||||||||| ||||| ||||| || || |||||||| Sbjct: 854 gtgtaggactgctggatggtctcgatgtcgagtcccttcagcttcacaacagactccaca 795 Query: 267 tgccctttgagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcctct 326 ||||| ||||| || |||||||||| || |||||| ||||||||||||||||| |||||| Sbjct: 794 tgccccttgagtgtgtgaagctcccgcagccttgcaatctcggccctcctcttcgcctct 735 Query: 327 tcagcca 333 ||||||| Sbjct: 734 tcagcca 728
>dbj|AK071252.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088D22, full insert sequence Length = 1702 Score = 117 bits (59), Expect = 2e-23 Identities = 116/135 (85%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 258 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 1287 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 1228 Query: 259 actccacgtgccctttgagcgtatgaagctccctcaaccttgcgatctcggccctcctct 318 | || || ||||| ||||||||||| |||||||| | ||| || ||||| |||||||||| Sbjct: 1227 attctacatgccccttgagcgtatggagctccctaagcctggcaatctccgccctcctct 1168 Query: 319 tggcctcttcagcca 333 | ||||||||||||| Sbjct: 1167 tcgcctcttcagcca 1153
>dbj|AK067535.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013109J17, full insert sequence Length = 3286 Score = 117 bits (59), Expect = 2e-23 Identities = 116/135 (85%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 258 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 2929 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 2870 Query: 259 actccacgtgccctttgagcgtatgaagctccctcaaccttgcgatctcggccctcctct 318 | || || ||||| ||||||||||| |||||||| | ||| || ||||| |||||||||| Sbjct: 2869 attctacatgccccttgagcgtatggagctccctaagcctggcaatctccgccctcctct 2810 Query: 319 tggcctcttcagcca 333 | ||||||||||||| Sbjct: 2809 tcgcctcttcagcca 2795
>dbj|D10207.1|RICOSA1 Oryza sativa OSA1 mRNA for H-ATPase, complete cds Length = 3053 Score = 93.7 bits (47), Expect = 3e-16 Identities = 107/127 (84%) Strand = Plus / Minus Query: 207 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 266 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 2894 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 2835 Query: 267 tgccctttgagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcctct 326 ||||| || ||||||||||||||||| | |||||| ||||||||||||| || |||||| Sbjct: 2834 tgccccttcagcgtatgaagctccctgagccttgcaatctcggccctccgtttcgcctct 2775 Query: 327 tcagcca 333 || |||| Sbjct: 2774 tccgcca 2768
>dbj|AK068765.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013162E15, full insert sequence Length = 3307 Score = 93.7 bits (47), Expect = 3e-16 Identities = 107/127 (84%) Strand = Plus / Minus Query: 207 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 266 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 3143 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 3084 Query: 267 tgccctttgagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcctct 326 ||||| || ||||||||||||||||| | |||||| ||||||||||||| || |||||| Sbjct: 3083 tgccccttcagcgtatgaagctccctgagccttgcaatctcggccctccgtttcgcctct 3024 Query: 327 tcagcca 333 || |||| Sbjct: 3023 tccgcca 3017
>emb|AJ539534.1|ZMA539534 Zea mays partial mRNA for proton-exporting ATPase (mha4 gene) Length = 1359 Score = 91.7 bits (46), Expect = 1e-15 Identities = 94/110 (85%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 924 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 865 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | ||||||| || ||| ||||||||||| | ||||||||||| Sbjct: 864 gagggtgttgagctcccgcagcctcgcgatctcggcgcgcctcttggcct 815
>gb|AY104577.1| Zea mays PCO137756 mRNA sequence Length = 1308 Score = 89.7 bits (45), Expect = 5e-15 Identities = 78/89 (87%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 ||||||||| |||||| ||||| || |||||||| ||||||||||||||||||||||| Sbjct: 1231 acggtgtagctctgctgaatggtgtcaatgtcgaggcccttgagcttgacgacggactcg 1172 Query: 264 acgtgccctttgagcgtatgaagctccct 292 ||||| || |||||||| || |||||||| Sbjct: 1171 acgtgtcccttgagcgtgtgcagctccct 1143
>gb|AY136627.1| Hordeum vulgare subsp. vulgare plasma membrane P-type proton pump ATPase (Ha1) mRNA, complete cds Length = 3446 Score = 83.8 bits (42), Expect = 3e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 221 gatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgt 280 |||||| |||||||| || ||||||||||| || |||||||| |||||||| ||||| || Sbjct: 3031 gatggtgtcgatgtcaaggcccttgagcttcaccacggactcaacgtgccccttgagtgt 2972 Query: 281 atgaagctccctcaaccttgcgatctcggccctcctcttggc 322 | ||||||||||||||||| ||||| || || |||||||| Sbjct: 2971 gttgagctccctcaaccttgcaatctcagctcttctcttggc 2930
>emb|AJ344078.1|HVU344078 Hordeum vulgare partial mRNA for plasma membrane H+-ATPase (ha1 gene) Length = 2280 Score = 83.8 bits (42), Expect = 3e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 221 gatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgt 280 |||||| |||||||| || ||||||||||| || |||||||| |||||||| ||||| || Sbjct: 1888 gatggtgtcgatgtcaaggcccttgagcttcaccacggactcaacgtgccccttgagtgt 1829 Query: 281 atgaagctccctcaaccttgcgatctcggccctcctcttggc 322 | ||||||||||||||||| ||||| || || |||||||| Sbjct: 1828 gttgagctccctcaaccttgcaatctcagctcttctcttggc 1787
>gb|AF480431.1| Zea mays plasma membrane H+ ATPase-like gene, partial sequence Length = 6539 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Plus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 2510 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 2569 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 2570 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 2619
>gb|AF498616.1| Zea mays cultivar C_9 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 408 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 138 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 79 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 78 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 29
>gb|AF498615.1| Zea mays cultivar D_9 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498614.1| Zea mays cultivar D_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498613.1| Zea mays cultivar F_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498612.1| Zea mays cultivar Mo17 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498611.1| Zea mays cultivar D_7 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 410 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 80 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 31
>gb|AF498610.1| Zea mays cultivar TX601 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 395 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 138 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 79 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 78 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 29
>gb|AF498609.1| Zea mays cultivar B84 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498608.1| Zea mays cultivar DE811 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498607.1| Zea mays cultivar 684 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498606.1| Zea mays cultivar D71-4HT plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498605.1| Zea mays cultivar H99 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 264 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 80 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 31
>gb|AF498604.1| Zea mays cultivar IVANA plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 414 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 144 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 85 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 84 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 35
>gb|AF498603.1| Zea mays cultivar CO109 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 412 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 142 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 83 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 82 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 33
>gb|AF498602.1| Zea mays cultivar I_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498601.1| Zea mays cultivar B73 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 335 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 82 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 81 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 32
>gb|AF498600.1| Zea mays cultivar F_2 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 411 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 82 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 81 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 32
>gb|AF498599.1| Zea mays cultivar G_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 406 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498598.1| Zea mays cultivar B_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498597.1| Zea mays cultivar H_4 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 412 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 80 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 31
>gb|AF498596.1| Zea mays cultivar F_4 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498595.1| Zea mays cultivar F_3 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 410 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 80 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 31
>gb|AF498594.1| Zea mays cultivar F_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498593.1| Zea mays cultivar H_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498592.1| Zea mays cultivar H_3 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498591.1| Zea mays cultivar J40 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 397 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498590.1| Zea mays cultivar 647 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498589.1| Zea mays cultivar B_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498588.1| Zea mays cultivar F_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498587.1| Zea mays cultivar C_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 34
>gb|AF498586.1| Zea mays cultivar H_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 404 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 82 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 81 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 32
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 83.8 bits (42), Expect = 3e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 258 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 27429483 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 27429424 Query: 259 actccacgtgccctttgagcgtatgaagctccct 292 | || || ||||| ||||||||||| |||||||| Sbjct: 27429423 attctacatgccccttgagcgtatggagctccct 27429390 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 303 atctcggccctcctcttggcctcttcagcca 333 ||||| ||||||||||| ||||||||||||| Sbjct: 27429141 atctccgccctcctcttcgcctcttcagcca 27429111
>emb|AL928743.1|CNS08CBG Oryza sativa chromosome 12, . BAC OSJNBb0011N16 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 55237 Score = 83.8 bits (42), Expect = 3e-13 Identities = 81/94 (86%) Strand = Plus / Plus Query: 199 atcaaacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 258 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 52335 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 52394 Query: 259 actccacgtgccctttgagcgtatgaagctccct 292 | || || ||||| ||||||||||| |||||||| Sbjct: 52395 attctacatgccccttgagcgtatggagctccct 52428 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Plus Query: 303 atctcggccctcctcttggcctcttcagcca 333 ||||| ||||||||||| ||||||||||||| Sbjct: 52677 atctccgccctcctcttcgcctcttcagcca 52707
>emb|AJ441084.1|ZMA441084 Zea mays partial mRNA for proton-exporting ATPase (mha3 gene) Length = 1259 Score = 83.8 bits (42), Expect = 3e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 924 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 865 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 864 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 815
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 83.8 bits (42), Expect = 3e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 258 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 27355083 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 27355024 Query: 259 actccacgtgccctttgagcgtatgaagctccct 292 | || || ||||| ||||||||||| |||||||| Sbjct: 27355023 attctacatgccccttgagcgtatggagctccct 27354990 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 303 atctcggccctcctcttggcctcttcagcca 333 ||||| ||||||||||| ||||||||||||| Sbjct: 27354741 atctccgccctcctcttcgcctcttcagcca 27354711
>emb|AL732378.3|CNS08C91 Oryza sativa chromosome 12, . BAC OSJNBa0063N15 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 109222 Score = 83.8 bits (42), Expect = 3e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 258 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 5397 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 5338 Query: 259 actccacgtgccctttgagcgtatgaagctccct 292 | || || ||||| ||||||||||| |||||||| Sbjct: 5337 attctacatgccccttgagcgtatggagctccct 5304 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 303 atctcggccctcctcttggcctcttcagcca 333 ||||| ||||||||||| ||||||||||||| Sbjct: 5055 atctccgccctcctcttcgcctcttcagcca 5025
>emb|AL731762.2|CNS07YPW Oryza sativa chromosome 12, . BAC OJ1119_E02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 124605 Score = 83.8 bits (42), Expect = 3e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 258 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 97803 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 97744 Query: 259 actccacgtgccctttgagcgtatgaagctccct 292 | || || ||||| ||||||||||| |||||||| Sbjct: 97743 attctacatgccccttgagcgtatggagctccct 97710 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 303 atctcggccctcctcttggcctcttcagcca 333 ||||| ||||||||||| ||||||||||||| Sbjct: 97461 atctccgccctcctcttcgcctcttcagcca 97431
>gb|AC134344.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0059K16, complete sequence Length = 139615 Score = 81.8 bits (41), Expect = 1e-12 Identities = 80/93 (86%) Strand = Plus / Plus Query: 218 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 131579 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 131638 Query: 278 cgtatgaagctccctcaaccttgcgatctcggc 310 ||| || ||||||| | ||| ||||||||||| Sbjct: 131639 cgtgtgcagctcccgtagcctggcgatctcggc 131671
>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0006B22, complete sequence Length = 166052 Score = 81.8 bits (41), Expect = 1e-12 Identities = 80/93 (86%) Strand = Plus / Plus Query: 218 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 50699 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 50758 Query: 278 cgtatgaagctccctcaaccttgcgatctcggc 310 ||| || ||||||| | ||| ||||||||||| Sbjct: 50759 cgtgtgcagctcccgtagcctggcgatctcggc 50791
>emb|AJ440002.1|OSA440002 Oryza sativa (japonica cultivar-group) a4 gene for plasma membrane H+ ATPase, exons 1-12 Length = 3894 Score = 81.8 bits (41), Expect = 1e-12 Identities = 80/93 (86%) Strand = Plus / Minus Query: 218 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 3876 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 3817 Query: 278 cgtatgaagctccctcaaccttgcgatctcggc 310 ||| || ||||||| | ||| ||||||||||| Sbjct: 3816 cgtgtgcagctcccgtagcctggcgatctcggc 3784
>emb|AJ440001.1|OSA440001 Oryza sativa (japonica cultivar-group) a3 gene for plasma membrane H+ ATPase, exons 1-21 Length = 6072 Score = 81.8 bits (41), Expect = 1e-12 Identities = 77/89 (86%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 |||||||| ||||||||||||||||| |||||||| || |||||||| || || || || Sbjct: 6068 acggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccgattct 6009 Query: 264 acgtgccctttgagcgtatgaagctccct 292 || ||||| ||||||||||| |||||||| Sbjct: 6008 acatgccccttgagcgtatggagctccct 5980 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 303 atctcggccctcctcttggcctcttcagcca 333 ||||| ||||||||||| ||||||||||||| Sbjct: 5731 atctccgccctcctcttcgcctcttcagcca 5701
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 81.8 bits (41), Expect = 1e-12 Identities = 80/93 (86%) Strand = Plus / Plus Query: 218 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 14715285 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 14715344 Query: 278 cgtatgaagctccctcaaccttgcgatctcggc 310 ||| || ||||||| | ||| ||||||||||| Sbjct: 14715345 cgtgtgcagctcccgtagcctggcgatctcggc 14715377
>dbj|AK100483.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023097B04, full insert sequence Length = 3538 Score = 81.8 bits (41), Expect = 1e-12 Identities = 80/93 (86%) Strand = Plus / Minus Query: 218 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 3135 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 3076 Query: 278 cgtatgaagctccctcaaccttgcgatctcggc 310 ||| || ||||||| | ||| ||||||||||| Sbjct: 3075 cgtgtgcagctcccgtagcctggcgatctcggc 3043
>dbj|AK099106.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028O04, full insert sequence Length = 1472 Score = 81.8 bits (41), Expect = 1e-12 Identities = 80/93 (86%) Strand = Plus / Minus Query: 218 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 1187 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 1128 Query: 278 cgtatgaagctccctcaaccttgcgatctcggc 310 ||| || ||||||| | ||| ||||||||||| Sbjct: 1127 cgtgtgcagctcccgtagcctggcgatctcggc 1095
>dbj|AK069666.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028O05, full insert sequence Length = 1472 Score = 81.8 bits (41), Expect = 1e-12 Identities = 80/93 (86%) Strand = Plus / Minus Query: 218 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 1187 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 1128 Query: 278 cgtatgaagctccctcaaccttgcgatctcggc 310 ||| || ||||||| | ||| ||||||||||| Sbjct: 1127 cgtgtgcagctcccgtagcctggcgatctcggc 1095
>gb|AF029256.2|AF029256 Kosteletzkya virginica KVATP1 plasma membrane proton ATPase (ATP1) mRNA, complete cds Length = 3175 Score = 77.8 bits (39), Expect = 2e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||||| ||||| Sbjct: 2872 ctgctggatcgtatcgatgtccagccccttcagctttacgacagactcgacgtgaccttt 2813 Query: 275 gagcgtatgaagctc 289 ||||||||||||||| Sbjct: 2812 gagcgtatgaagctc 2798
>gb|AY109425.1| Zea mays CL1965_1 mRNA sequence Length = 3431 Score = 75.8 bits (38), Expect = 8e-11 Identities = 92/110 (83%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 ||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 3046 ctgctggatggggtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 2987 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 2986 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 2937
>gb|AY103963.1| Zea mays PCO106203 mRNA sequence Length = 1358 Score = 73.8 bits (37), Expect = 3e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagaccctt 244 |||||||||||||||||||||||||||||||| |||||||| Sbjct: 971 acggtgtaggactgctggatggtctcgatgtccagaccctt 931
>ref|XM_468274.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2853 Score = 69.9 bits (35), Expect = 5e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 ||||||||| ||| ||||| || ||||||||||| ||||||||||| || || ||||| Sbjct: 2849 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 2790 Query: 264 acgtgccctttgagcgtatgaagctccctca 294 |||||||| |||||||| || | |||||||| Sbjct: 2789 acgtgccccttgagcgtgtgcaactccctca 2759
>emb|AJ440217.1|OSA440217 Oryza sativa a6 gene for plasma membrane H+-ATPase Length = 4058 Score = 69.9 bits (35), Expect = 5e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 ||||||||| ||| ||||| || ||||||||||| ||||||||||| || || ||||| Sbjct: 4054 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 3995 Query: 264 acgtgccctttgagcgtatgaagctccctca 294 |||||||| |||||||| || | |||||||| Sbjct: 3994 acgtgccccttgagcgtgtgcaactccctca 3964
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 69.9 bits (35), Expect = 5e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 ||||||||| ||| ||||| || ||||||||||| ||||||||||| || || ||||| Sbjct: 33954341 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 33954282 Query: 264 acgtgccctttgagcgtatgaagctccctca 294 |||||||| |||||||| || | |||||||| Sbjct: 33954281 acgtgccccttgagcgtgtgcaactccctca 33954251
>dbj|AP003975.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1004_E04 Length = 133621 Score = 69.9 bits (35), Expect = 5e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 ||||||||| ||| ||||| || ||||||||||| ||||||||||| || || ||||| Sbjct: 113304 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 113245 Query: 264 acgtgccctttgagcgtatgaagctccctca 294 |||||||| |||||||| || | |||||||| Sbjct: 113244 acgtgccccttgagcgtgtgcaactccctca 113214
>gb|AC097277.6| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete sequence Length = 150155 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 207 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 266 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 78620 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 78679 Query: 267 tgccctttgagcgtatgaagctccct 292 ||||| || ||||||||||||||||| Sbjct: 78680 tgccccttcagcgtatgaagctccct 78705
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 207 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 266 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 27225775 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 27225716 Query: 267 tgccctttgagcgtatgaagctccct 292 ||||| || ||||||||||||||||| Sbjct: 27225715 tgccccttcagcgtatgaagctccct 27225690
>emb|X85805.1|ZMPMHATP Z.mays mRNA for plasma membrane H+ ATPase Length = 3369 Score = 67.9 bits (34), Expect = 2e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 |||||||||||| |||||||| || ||||||||||| | || ||||||||||| || || Sbjct: 3037 ctgctggatggtgtcgatgtccaggcccttgagcttagccaccgactccacgtggccctt 2978 Query: 275 gagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcct 324 ||| || | |||||||||| ||| |||||||| || | |||||||||| Sbjct: 2977 gagggtgttgagctccctcagcctcgcgatctcagctcgtctcttggcct 2928
>emb|AJ439999.1|OSA439999 Oryza sativa (japonica cultivar-group) a1 gene for plasma membrane H+ ATPase, exons 1-21 Length = 6701 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 207 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 266 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 6694 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 6635 Query: 267 tgccctttgagcgtatgaagctccct 292 ||||| || ||||||||||||||||| Sbjct: 6634 tgccccttcagcgtatgaagctccct 6609
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 207 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 266 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 27317098 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 27317039 Query: 267 tgccctttgagcgtatgaagctccct 292 ||||| || ||||||||||||||||| Sbjct: 27317038 tgccccttcagcgtatgaagctccct 27317013
>gb|AY543630.1| Triticum aestivum plasma membrane H+-ATPase (ha1) mRNA, complete cds Length = 2856 Score = 63.9 bits (32), Expect = 3e-07 Identities = 86/104 (82%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 ||||||||| ||| | |||||| |||||||| || ||||||||||| || ||||| || Sbjct: 2852 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 2793 Query: 264 acgtgccctttgagcgtatgaagctccctcaaccttgcgatctc 307 ||||| || ||||| || | ||||||||||||||||| ||||| Sbjct: 2792 acgtggcccttgagtgtgttgagctccctcaaccttgcaatctc 2749
>dbj|AK121272.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023107A16, full insert sequence Length = 3134 Score = 63.9 bits (32), Expect = 3e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 219 tggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagc 278 ||||| || ||||||||||| ||||||||||| || || ||||| |||||||| |||||| Sbjct: 2811 tggattgtgtcgatgtcgagccccttgagcttcaccaccgactctacgtgccccttgagc 2752 Query: 279 gtatgaagctccctca 294 || || | |||||||| Sbjct: 2751 gtgtgcaactccctca 2736
>gb|AF384148.1|AF384148 Triticum aestivum H+-ATPase mRNA, partial cds Length = 437 Score = 56.0 bits (28), Expect = 7e-05 Identities = 85/104 (81%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 ||||||||| ||| | |||||| |||||||| || ||||||||||| || ||||| || Sbjct: 407 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 348 Query: 264 acgtgccctttgagcgtatgaagctccctcaaccttgcgatctc 307 ||||| || ||||| || | |||| |||||||||||| ||||| Sbjct: 347 acgtggcccttgagtgtgttgagcttcctcaaccttgcaatctc 304
>ref|NM_125118.2| Arabidopsis thaliana AHA3; ATPase AT5G57350 (AHA3) mRNA, complete cds Length = 3226 Score = 54.0 bits (27), Expect = 3e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 225 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 284 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 2875 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 2816 Query: 285 agctccctcaaccttgcgatctc 307 || ||||| | |||||||||||| Sbjct: 2815 agttccctaagccttgcgatctc 2793
>gb|AY072153.1| Arabidopsis thaliana putative plasma membrane proton pump ATPase 3 (At5g57350) mRNA, complete cds Length = 3185 Score = 54.0 bits (27), Expect = 3e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 225 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 284 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 2865 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 2806 Query: 285 agctccctcaaccttgcgatctc 307 || ||||| | |||||||||||| Sbjct: 2805 agttccctaagccttgcgatctc 2783
>gb|AY056780.1| Arabidopsis thaliana AT5g57350/MJB24_16 mRNA, complete cds Length = 3159 Score = 54.0 bits (27), Expect = 3e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 225 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 284 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 2875 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 2816 Query: 285 agctccctcaaccttgcgatctc 307 || ||||| | |||||||||||| Sbjct: 2815 agttccctaagccttgcgatctc 2793
>gb|AY989894.1| Lupinus albus plasma membrane H+ ATPase (LHA3) mRNA, complete cds Length = 3332 Score = 54.0 bits (27), Expect = 3e-04 Identities = 72/87 (82%) Strand = Plus / Minus Query: 215 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 274 ||||||||| || || ||||| || ||||| ||||| || || || ||||| |||||||| Sbjct: 3032 ctgctggattgtatcaatgtctagtcccttcagcttcaccactgattccacatgcccttt 2973 Query: 275 gagcgtatgaagctccctcaaccttgc 301 || |||||||||||||| | |||||| Sbjct: 2972 tagagtatgaagctccctaagccttgc 2946
>emb|BX833784.1|CNS0A208 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL76ZH09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 824 Score = 54.0 bits (27), Expect = 3e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 225 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 284 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 519 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 460 Query: 285 agctccctcaaccttgcgatctc 307 || ||||| | |||||||||||| Sbjct: 459 agttccctaagccttgcgatctc 437
>gb|M60166.1|TOMLHA1 Tomato (L.esculentum) H+-ATPase (LHA1) mRNA, complete cds Length = 3229 Score = 54.0 bits (27), Expect = 3e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 202 aaacggtgtaggactgctggatggtctcgatgtcgagaccctt 244 |||||||||| |||||||| || ||||| |||||||||||||| Sbjct: 2989 aaacggtgtatgactgctgaattgtctcaatgtcgagaccctt 2947
>emb|AJ271439.1|PPE271439 Prunus persica mRNA for plasma membrane H+ ATPase (PPA1 gene) Length = 3344 Score = 52.0 bits (26), Expect = 0.001 Identities = 59/70 (84%) Strand = Plus / Minus Query: 264 acgtgccctttgagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcc 323 ||||| ||||| || || || ||||||||||||||||| ||||| || || || ||||| Sbjct: 3059 acgtgacctttcagtgtgtggagctccctcaaccttgcaatctcagctcttcttttggct 3000 Query: 324 tcttcagcca 333 |||||||||| Sbjct: 2999 tcttcagcca 2990
>ref|NM_125662.2| Arabidopsis thaliana ATPase AT5G62670 mRNA, complete cds Length = 4410 Score = 48.1 bits (24), Expect = 0.018 Identities = 45/52 (86%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggcctcttcagcca 333 |||||||||| |||||| ||||||||||| || ||||| || ||||| |||| Sbjct: 2937 tgaagctcccgcaacctggcgatctcggctcttctcttagcttcttcggcca 2886
>gb|BT010748.1| Arabidopsis thaliana At5g62670/MRG21_9 gene, complete cds Length = 2871 Score = 48.1 bits (24), Expect = 0.018 Identities = 45/52 (86%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggcctcttcagcca 333 |||||||||| |||||| ||||||||||| || ||||| || ||||| |||| Sbjct: 2789 tgaagctcccgcaacctggcgatctcggctcttctcttagcttcttcggcca 2738
>emb|AJ222786.1|HVJ222786 Hordeum vulgare mRNA for H(+)-transporting ATPase-like protein, clone RG135 Length = 350 Score = 48.1 bits (24), Expect = 0.018 Identities = 57/68 (83%) Strand = Plus / Minus Query: 240 cccttgagcttgacgacggactccacgtgccctttgagcgtatgaagctccctcaacctt 299 ||||||||||| || |||||||| |||||||| | ||| || | |||||||||||||| Sbjct: 349 cccttgagcttcaccacggactcaacgtgcccctggagtgtgttgagctccctcaaccta 290 Query: 300 gcgatctc 307 || ||||| Sbjct: 289 gcaatctc 282
>gb|AY125493.1| Arabidopsis thaliana AT5g62670/MRG21_9 mRNA, complete cds Length = 3264 Score = 48.1 bits (24), Expect = 0.018 Identities = 45/52 (86%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggcctcttcagcca 333 |||||||||| |||||| ||||||||||| || ||||| || ||||| |||| Sbjct: 2935 tgaagctcccgcaacctggcgatctcggctcttctcttagcttcttcggcca 2884
>dbj|D45189.1|ZMUZHA1 Zostera marina mRNA for putative plasma membrane H+-ATPase, complete cds Length = 3250 Score = 48.1 bits (24), Expect = 0.018 Identities = 54/64 (84%) Strand = Plus / Minus Query: 202 aaacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 261 ||||||||||| |||||||||||| || ||||| ||||| || ||||| || || |||| Sbjct: 3004 aaacggtgtagttctgctggatggtttcaatgtcaagacctttaagcttcaccaccgact 2945 Query: 262 ccac 265 |||| Sbjct: 2944 ccac 2941
>gb|AY829002.2| Triticum aestivum plasma membrane H+-ATPase gene, promoter region and complete cds Length = 6132 Score = 46.1 bits (23), Expect = 0.071 Identities = 77/95 (81%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 263 ||||||||| ||| | |||||| |||||||| || ||||||||||| || ||||| || Sbjct: 6120 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 6061 Query: 264 acgtgccctttgagcgtatgaagctccctcaacct 298 ||||| | ||||| || | |||||||||||||| Sbjct: 6060 acgtggctcttgagtgtgttgagctccctcaacct 6026
>ref|NM_126721.2| Arabidopsis thaliana ATPase AT2G07560 mRNA, complete cds Length = 3332 Score = 46.1 bits (23), Expect = 0.071 Identities = 41/47 (87%) Strand = Plus / Minus Query: 231 atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 2879 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 2833
>emb|AJ310523.1|VFA310523 Vicia faba L. mRNA for P-type H+-ATPase (vha4 gene) Length = 3130 Score = 46.1 bits (23), Expect = 0.071 Identities = 47/55 (85%) Strand = Plus / Minus Query: 279 gtatgaagctccctcaaccttgcgatctcggccctcctcttggcctcttcagcca 333 ||||||||||| ||||||||||| || ||||| ||||| || || ||||| |||| Sbjct: 2872 gtatgaagctctctcaaccttgcaatttcggctctccttttagcttcttcggcca 2818
>gb|AC007662.3| Arabidopsis thaliana chromosome 2 BAC F9A16 genomic sequence, complete sequence Length = 102249 Score = 46.1 bits (23), Expect = 0.071 Identities = 41/47 (87%) Strand = Plus / Minus Query: 231 atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 43890 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 43844
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctc 229 |||| |||||||| ||||||||||||||||| Sbjct: 4952558 atcacacggtgtatgactgctggatggtctc 4952528
>gb|BT002855.1| Arabidopsis thaliana clone RAFL15-05-H02 (R20351) putative plasma membrane proton ATPase (At2g07560) mRNA, partial cds Length = 1444 Score = 46.1 bits (23), Expect = 0.071 Identities = 41/47 (87%) Strand = Plus / Minus Query: 231 atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 277 ||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 975 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 929
>dbj|AP005173.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0003E08 Length = 161095 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctc 229 |||| |||||||| ||||||||||||||||| Sbjct: 138042 atcacacggtgtatgactgctggatggtctc 138012
>dbj|AK121402.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131O20, full insert sequence Length = 3388 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctc 229 |||| |||||||| ||||||||||||||||| Sbjct: 3006 atcacacggtgtatgactgctggatggtctc 2976 Score = 40.1 bits (20), Expect = 4.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 285 agctccctcaaccttgcgatctcggccctcct 316 ||||| |||||||||||||| ||||| ||||| Sbjct: 2920 agctctctcaaccttgcgatttcggctctcct 2889
>dbj|AK072909.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023148A19, full insert sequence Length = 2685 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctc 229 |||| |||||||| ||||||||||||||||| Sbjct: 2439 atcacacggtgtatgactgctggatggtctc 2409 Score = 40.1 bits (20), Expect = 4.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 285 agctccctcaaccttgcgatctcggccctcct 316 ||||| |||||||||||||| ||||| ||||| Sbjct: 2353 agctctctcaaccttgcgatttcggctctcct 2322
>dbj|D31843.1|RICOSA2 Oryza sativa (japonica cultivar-group) mRNA for plasma membrane H+-ATPase, complete cds Length = 3264 Score = 46.1 bits (23), Expect = 0.071 Identities = 29/31 (93%) Strand = Plus / Minus Query: 199 atcaaacggtgtaggactgctggatggtctc 229 |||| |||||||| ||||||||||||||||| Sbjct: 3005 atcacacggtgtatgactgctggatggtctc 2975 Score = 40.1 bits (20), Expect = 4.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 285 agctccctcaaccttgcgatctcggccctcct 316 ||||| |||||||||||||| ||||| ||||| Sbjct: 2919 agctctctcaaccttgcgatttcggctctcct 2888
>ref|XM_476966.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2874 Score = 44.1 bits (22), Expect = 0.28 Identities = 25/26 (96%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctc 229 |||||||| ||||||||||||||||| Sbjct: 2870 acggtgtatgactgctggatggtctc 2845 Score = 40.1 bits (20), Expect = 4.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 285 agctccctcaaccttgcgatctcggccctcct 316 ||||| |||||||||||||| ||||| ||||| Sbjct: 2789 agctctctcaaccttgcgatttcggctctcct 2758
>emb|AJ440000.1|OSA440000 Oryza sativa (japonica cultivar-group) a2 gene for plasma membrane H+ ATPase, exons 1-21 Length = 5622 Score = 44.1 bits (22), Expect = 0.28 Identities = 25/26 (96%) Strand = Plus / Minus Query: 204 acggtgtaggactgctggatggtctc 229 |||||||| ||||||||||||||||| Sbjct: 5618 acggtgtatgactgctggatggtctc 5593
>emb|AJ295612.1|HVU295612 Hordeum vulgare partial mRNA for plasma membrane proton ATPase (PPA1 gene) Length = 1049 Score = 44.1 bits (22), Expect = 0.28 Identities = 34/38 (89%) Strand = Plus / Minus Query: 285 agctccctcaaccttgcgatctcggccctcctcttggc 322 ||||||||||||||||| ||||| || || |||||||| Sbjct: 1032 agctccctcaaccttgcaatctcagctcttctcttggc 995
>emb|Y09815.1|TAPSB5 T.aestivum mRNA for transmembrane proton pump, partial Length = 863 Score = 44.1 bits (22), Expect = 0.28 Identities = 34/38 (89%) Strand = Plus / Minus Query: 285 agctccctcaaccttgcgatctcggccctcctcttggc 322 ||||||||||||||||| ||||| || || |||||||| Sbjct: 511 agctccctcaaccttgcaatctcagctcttctcttggc 474
>ref|NM_114664.2| Arabidopsis thaliana AHA4; ATPase AT3G47950 (AHA4) mRNA, complete cds Length = 4073 Score = 42.1 bits (21), Expect = 1.1 Identities = 51/61 (83%) Strand = Plus / Minus Query: 273 ttgagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcctcttcagcc 332 |||||||| ||||| || | |||||| || || || || ||||||||||| ||||||||| Sbjct: 2949 ttgagcgtgtgaagttcacgcaacctagcaatttcagctctcctcttggcttcttcagcc 2890 Query: 333 a 333 | Sbjct: 2889 a 2889
>ref|NM_127453.2| Arabidopsis thaliana AHA1 (PLASMA MEMBRANE PROTON ATPASE); ATPase AT2G18960 (AHA1) mRNA, complete cds Length = 3428 Score = 42.1 bits (21), Expect = 1.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggc 322 ||||||||||| | ||| || ||||||||||| |||||||| Sbjct: 2995 tgaagctccctaagcctagctatctcggcccttctcttggc 2955
>ref|NM_031024.1| Rattus norvegicus drebrin 1 (Dbn1), mRNA Length = 2697 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 311 cctcctcttggcctcttcagc 331 ||||||||||||||||||||| Sbjct: 803 cctcctcttggcctcttcagc 783
>gb|BT008692.1| Arabidopsis thaliana clone RAFL09-75-I01 (R19670) putative plasma membrane proton ATPase (PMA) (At2g18960) mRNA, complete cds Length = 3186 Score = 42.1 bits (21), Expect = 1.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggc 322 ||||||||||| | ||| || ||||||||||| |||||||| Sbjct: 2867 tgaagctccctaagcctagctatctcggcccttctcttggc 2827
>dbj|AK221932.1| Arabidopsis thaliana mRNA for plasma membrane proton ATPase, complete cds, clone: RAFL22-42-A02 Length = 1120 Score = 42.1 bits (21), Expect = 1.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggc 322 ||||||||||| | ||| || ||||||||||| |||||||| Sbjct: 734 tgaagctccctaagcctagctatctcggcccttctcttggc 694
>gb|AY029190.1| Lilium longiflorum plasma membrane H+ ATPase mRNA, complete cds Length = 3167 Score = 42.1 bits (21), Expect = 1.1 Identities = 45/53 (84%) Strand = Plus / Minus Query: 240 cccttgagcttgacgacggactccacgtgccctttgagcgtatgaagctccct 292 ||||||||||| || || ||||| |||||||| ||||| || || |||||||| Sbjct: 2903 cccttgagcttcacaaccgactcgacgtgccccttgagagtgtggagctccct 2851
>emb|BX821819.1|CNS0A87I Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL77ZC04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 778 Score = 42.1 bits (21), Expect = 1.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggc 322 ||||||||||| | ||| || ||||||||||| |||||||| Sbjct: 467 tgaagctccctaagcctagctatctcggcccttctcttggc 427
>emb|BX820549.1|CNS0A7YO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH47ZE08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 3173 Score = 42.1 bits (21), Expect = 1.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggc 322 ||||||||||| | ||| || ||||||||||| |||||||| Sbjct: 2862 tgaagctccctaagcctagctatctcggcccttctcttggc 2822
>dbj|AK118088.1| Arabidopsis thaliana At3g47950 mRNA for putative H+-transporting ATPase, complete cds, clone: RAFL19-34-A17 Length = 3220 Score = 42.1 bits (21), Expect = 1.1 Identities = 51/61 (83%) Strand = Plus / Minus Query: 273 ttgagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcctcttcagcc 332 |||||||| ||||| || | |||||| || || || || ||||||||||| ||||||||| Sbjct: 2949 ttgagcgtgtgaagttcacgcaacctagcaatttcagctctcctcttggcttcttcagcc 2890 Query: 333 a 333 | Sbjct: 2889 a 2889
>emb|X59267.1|RNDREBRIN R.norvegicus mRNA for drebrin A Length = 2697 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 311 cctcctcttggcctcttcagc 331 ||||||||||||||||||||| Sbjct: 803 cctcctcttggcctcttcagc 783
>gb|M24107.1|ATHHATPA A.thaliana plasma membrane proton ATPase (PMA) mRNA, complete cds Length = 3226 Score = 42.1 bits (21), Expect = 1.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 282 tgaagctccctcaaccttgcgatctcggccctcctcttggc 322 ||||||||||| | ||| || ||||||||||| |||||||| Sbjct: 2860 tgaagctccctaagcctagctatctcggcccttctcttggc 2820
>dbj|AB015042.1| Rattus norvegicus mRNA for drebrin E, partial cds Length = 1983 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 311 cctcctcttggcctcttcagc 331 ||||||||||||||||||||| Sbjct: 750 cctcctcttggcctcttcagc 730
>ref|XM_865196.1| PREDICTED: Bos taurus hypothetical protein LOC613951 (LOC613951), mRNA Length = 480 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 309 gccctcctcttggcctcttc 328 |||||||||||||||||||| Sbjct: 449 gccctcctcttggcctcttc 430
>gb|AE009036.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 62 of 256 of the complete sequence Length = 10029 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 215 ctgctggatggtctcgatgtcgag 238 |||||||| ||||||||||||||| Sbjct: 8243 ctgctggaaggtctcgatgtcgag 8266
>gb|J04737.1|ATHATP Arabidopsis thaliana ATPase gene, complete cds Length = 5646 Score = 40.1 bits (20), Expect = 4.4 Identities = 56/68 (82%) Strand = Plus / Minus Query: 225 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 284 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 5364 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 5305 Query: 285 agctccct 292 || ||||| Sbjct: 5304 agttccct 5297
>gb|AC112657.2| Homo sapiens X BAC RP11-647I17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 116810 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 113 cacagatccactcttcactc 132 |||||||||||||||||||| Sbjct: 79368 cacagatccactcttcactc 79349
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 215 ctgctggatggtctcgatgtcgag 238 |||||||| ||||||||||||||| Sbjct: 678827 ctgctggaaggtctcgatgtcgag 678850
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome Length = 3304561 Score = 40.1 bits (20), Expect = 4.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 caaactgcatcaccagcggg 50 |||||||||||||||||||| Sbjct: 1807036 caaactgcatcaccagcggg 1807055
>dbj|D21282.1|RICSS343 Oryza sativa SS343 mRNA for H+-ATPase, partial sequence Length = 192 Score = 40.1 bits (20), Expect = 4.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 285 agctccctcaaccttgcgatctcggccctcct 316 ||||| |||||||||||||| ||||| ||||| Sbjct: 142 agctctctcaaccttgcgatttcggctctcct 111
>dbj|AB019233.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB24 Length = 58589 Score = 40.1 bits (20), Expect = 4.4 Identities = 56/68 (82%) Strand = Plus / Plus Query: 225 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 284 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 55268 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 55327 Query: 285 agctccct 292 || ||||| Sbjct: 55328 agttccct 55335
>dbj|AB042103.1| Asparagus officinalis AoPOX1 mRNA for peroxidase, complete cds Length = 1159 Score = 40.1 bits (20), Expect = 4.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 229 cgatgtcgagacccttgagcttga 252 |||||||||| ||||||||||||| Sbjct: 556 cgatgtcgaggcccttgagcttga 533
>dbj|AB086374.1| Sesbania rostrata srha5 mRNA for plasma membrane H+-ATPase, complete cds Length = 3376 Score = 40.1 bits (20), Expect = 4.4 Identities = 53/64 (82%) Strand = Plus / Minus Query: 270 cctttgagcgtatgaagctccctcaaccttgcgatctcggccctcctcttggcctcttca 329 ||||| || ||||| || || ||||||||||| || || || |||||||| || |||||| Sbjct: 3086 cctttcagtgtatgcagttctctcaaccttgcaatttcagctctcctcttagcttcttca 3027 Query: 330 gcca 333 |||| Sbjct: 3026 gcca 3023 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,902,154 Number of Sequences: 3902068 Number of extensions: 1902154 Number of successful extensions: 31965 Number of sequences better than 10.0: 118 Number of HSP's better than 10.0 without gapping: 118 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 31750 Number of HSP's gapped (non-prelim): 214 length of query: 333 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 311 effective length of database: 17,147,199,772 effective search space: 5332779129092 effective search space used: 5332779129092 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
