ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl53g05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY104845.1| Zea mays PCO079090 mRNA sequence 82 1e-12
2emb|AL731614.4|OSJN00260 Oryza sativa genomic DNA, chromosome 4,... 72 1e-09
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 72 1e-09
4ref|XM_462711.1| Oryza sativa (japonica cultivar-group), predic... 70 5e-09
5emb|BX511216.7| Zebrafish DNA sequence from clone DKEY-27F16 in ... 44 0.31
6gb|AC154095.1| Homo sapiens chromosome 12 clone fa0961, complete... 42 1.2
7ref|XM_593602.2| PREDICTED: Bos taurus similar to membrane-assoc... 42 1.2
8gb|AC145895.2| Pan troglodytes BAC clone RP43-8H7 from 7, comple... 42 1.2
9gb|AC004843.1| Homo sapiens PAC clone RP4-612F12 from 7, complet... 42 1.2
10gb|AC153583.10| Mus musculus 6 BAC RP23-349K15 (Roswell Park Can... 42 1.2
11gb|AC126010.13| Medicago truncatula clone mth2-20e4, complete se... 42 1.2
12emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete... 42 1.2
13emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome 42 1.2
14emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, comple... 42 1.2
15emb|AJ418370.1|MTR418370 Medicago truncatula nork gene for nodul... 42 1.2
16gb|AC010422.7| Homo sapiens chromosome 19 clone CTD-2192J16, com... 42 1.2
17dbj|AK124780.1| Homo sapiens cDNA FLJ42790 fis, clone BRAWH3007455 42 1.2
18gb|AY676457.1| Medicago littoralis genotype L000558 nodulation r... 42 1.2
19gb|AY676456.1| Medicago truncatula var. tricycla genotype L00054... 42 1.2
20gb|AY676455.1| Medicago truncatula genotype L000550 nodulation r... 42 1.2
21gb|AY676454.1| Medicago truncatula genotype L000536 nodulation r... 42 1.2
22gb|AY676453.1| Medicago truncatula genotype L000535 nodulation r... 42 1.2
23gb|AY676452.1| Medicago truncatula genotype L000551 nodulation r... 42 1.2
24gb|AY676451.1| Medicago truncatula genotype L000554 nodulation r... 42 1.2
25gb|AY676450.1| Medicago truncatula genotype L000549 nodulation r... 42 1.2
26gb|AY676449.1| Medicago truncatula genotype L000548 nodulation r... 42 1.2
27gb|AY676448.1| Medicago truncatula genotype L000547 nodulation r... 42 1.2
28gb|AY676447.1| Medicago truncatula genotype L000545 nodulation r... 42 1.2
29gb|AY676446.1| Medicago truncatula genotype L000543 nodulation r... 42 1.2
30gb|AY676445.1| Medicago truncatula genotype L000529 nodulation r... 42 1.2
31gb|AY676444.1| Medicago truncatula genotype L000537 nodulation r... 42 1.2
32gb|AY676443.1| Medicago truncatula genotype L000651 nodulation r... 42 1.2
33gb|AY676442.1| Medicago truncatula genotype L000648 nodulation r... 42 1.2
34gb|AY676441.1| Medicago truncatula genotype L000534 nodulation r... 42 1.2
35gb|AY676440.1| Medicago truncatula genotype L000557 nodulation r... 42 1.2
36gb|AY676439.1| Medicago truncatula genotype L000555 nodulation r... 42 1.2
37gb|AY676438.1| Medicago truncatula genotype L000552 nodulation r... 42 1.2
38gb|AY676437.1| Medicago truncatula genotype L000553 nodulation r... 42 1.2
39gb|AY676436.1| Medicago truncatula genotype L000544 nodulation r... 42 1.2
40gb|AY676435.1| Medicago truncatula genotype L000736 nodulation r... 42 1.2
41gb|AY676434.1| Medicago truncatula genotype L000734 nodulation r... 42 1.2
42gb|AY676433.1| Medicago truncatula genotype L000542 nodulation r... 42 1.2
43gb|AY676432.1| Medicago truncatula genotype L000538 nodulation r... 42 1.2
44gb|AY676431.1| Medicago truncatula genotype L000527 nodulation r... 42 1.2
45gb|AY676430.1| Medicago truncatula genotype L000531 nodulation r... 42 1.2
46gb|AY676429.1| Medicago truncatula genotype L000530 nodulation r... 42 1.2
47gb|AY676428.1| Medicago truncatula cultivar Jemalong A17 nodulat... 42 1.2
48gb|AC004080.2| Homo sapiens PAC clone RP1-170O19 from 7p15-p21, ... 42 1.2
49gb|AC024951.31| Homo sapiens chromosome 8 clone RP11-104C10, com... 42 1.2
50gb|AC153983.7| Mus musculus 6 BAC RP24-479J14 (Roswell Park Canc... 42 1.2
51gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, co... 42 1.2
52emb|AJ884582.1| Medicago sativa subsp. coerulea partial nork gen... 42 1.2
53gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, com... 40 4.8
54gb|AC093953.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.8
55gb|AC140465.2| Mus musculus BAC clone RP24-389J3 from chromosome... 40 4.8
56gb|AC145760.3| Microcebus murinus clone CH257-514K9, complete se... 40 4.8
57gb|U64841.1| Caenorhabditis elegans cosmid ZC142, complete sequence 40 4.8
58gb|AC133604.3| Mus musculus BAC clone RP23-416F12 from chromosom... 40 4.8
59gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete se... 40 4.8
60emb|AL356122.9| Human DNA sequence from clone RP11-61P22 on chro... 40 4.8
61gb|AC153760.3| Loxodonta africana clone VMRC15-151E6, complete s... 40 4.8
62gb|AC104334.2| Homo sapiens chromosome 1 clone RP11-411H5, compl... 40 4.8
63gb|AC131664.3| Mus musculus BAC clone RP23-274J16 from chromosom... 40 4.8
64gb|AC004155.1|AC004155 Mus musculus DNA from BAC 10818 containin... 40 4.8
65dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.8
66gb|AC020611.15| Homo sapiens 12 BAC RP11-1029F8 (Roswell Park Ca... 40 4.8
67emb|BX005279.12| Mouse DNA sequence from clone RP23-321B15 on ch... 40 4.8
68gb|AC159248.4| Mus musculus BAC clone RP24-254P11 from chromosom... 40 4.8
69emb|AL929457.12| Zebrafish DNA sequence from clone CH211-153I8 i... 40 4.8
70gb|AC005279.1|AC005279 Homo sapiens chromosome 17, clone hRPK.10... 40 4.8
71emb|BX510330.20| Zebrafish DNA sequence from clone DKEYP-82B3 in... 40 4.8
72gb|DP000022.1| Microcebus murinus target 1 genomic scaffold 40 4.8
73gb|AY067606.1| Schmidtea mediterranea clone H.37.3e unknown mRNA... 40 4.8 
>gb|AY104845.1| Zea mays PCO079090 mRNA sequence
          Length = 637

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 285 tgacgtcttttctggtatagtgaatacccaacaagagcagacagtagtatagtccataaa 344
           |||||| ||||||||||||| ||||| |||||||||||||||| || ||||||||| |||
Sbjct: 264 tgacgttttttctggtatagggaatatccaacaagagcagacaataatatagtccacaaa 205

                
Query: 345 accat 349
           |||||
Sbjct: 204 accat 200
to top
>emb|AL731614.4|OSJN00260 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0079F16,
              complete sequence
          Length = 157801

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 292    ttttctggtatagtgaatacccaacaagagcagacagtagtatagtccataaaacc 347
              |||||||| | ||||| || ||||||||||||||||||| ||||||||||||||||
Sbjct: 108134 ttttctggaagagtgagtatccaacaagagcagacagtaatatagtccataaaacc 108079
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 292      ttttctggtatagtgaatacccaacaagagcagacagtagtatagtccataaaacc 347
                |||||||| | ||||| || ||||||||||||||||||| ||||||||||||||||
Sbjct: 11939539 ttttctggaagagtgagtatccaacaagagcagacagtaatatagtccataaaacc 11939484
to top
>ref|XM_462711.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3447

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 292  ttttctggtatagtgaatacccaacaagagcagacagtagtatagtccataaaac 346
            |||||||| | ||||| || ||||||||||||||||||| |||||||||||||||
Sbjct: 3077 ttttctggaagagtgagtatccaacaagagcagacagtaatatagtccataaaac 3023
to top
>emb|BX511216.7| Zebrafish DNA sequence from clone DKEY-27F16 in linkage group 1, complete
              sequence
          Length = 169841

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 153    acaccatgattttatatgcact 174
              ||||||||||||||||||||||
Sbjct: 137295 acaccatgattttatatgcact 137274
to top
>gb|AC154095.1| Homo sapiens chromosome 12 clone fa0961, complete sequence
          Length = 38257

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 225   atctggaaataaagaaaaatc 245
             |||||||||||||||||||||
Sbjct: 22410 atctggaaataaagaaaaatc 22430
to top
>ref|XM_593602.2| PREDICTED: Bos taurus similar to membrane-associated ring finger
            (C3HC4) 6 (LOC540371), mRNA
          Length = 3503

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 275  gacttgttaatgacgtctttt 295
            |||||||||||||||||||||
Sbjct: 3114 gacttgttaatgacgtctttt 3134
to top
>gb|AC145895.2| Pan troglodytes BAC clone RP43-8H7 from 7, complete sequence
          Length = 170186

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 220    aaaatatctggaaataaagaa 240
              |||||||||||||||||||||
Sbjct: 143813 aaaatatctggaaataaagaa 143793
to top
>gb|AC004843.1| Homo sapiens PAC clone RP4-612F12 from 7, complete sequence
          Length = 136655

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 220    aaaatatctggaaataaagaa 240
              |||||||||||||||||||||
Sbjct: 126597 aaaatatctggaaataaagaa 126577
to top
>gb|AC153583.10| Mus musculus 6 BAC RP23-349K15 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 196821

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 311   cccaacaagagcagacagtag 331
             |||||||||||||||||||||
Sbjct: 35139 cccaacaagagcagacagtag 35159
to top
>gb|AC126010.13| Medicago truncatula clone mth2-20e4, complete sequence
          Length = 113964

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 217   gccaaaatatctggaaataaa 237
             |||||||||||||||||||||
Sbjct: 78056 gccaaaatatctggaaataaa 78076
to top
>emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete genome
          Length = 1512977

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 150    ctaacaccatgattttatatg 170
              |||||||||||||||||||||
Sbjct: 286879 ctaacaccatgattttatatg 286899
to top
>emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome
          Length = 1499920

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 150    ctaacaccatgattttatatg 170
              |||||||||||||||||||||
Sbjct: 283762 ctaacaccatgattttatatg 283782
to top
>emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, complete genome
          Length = 1516355

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 150    ctaacaccatgattttatatg 170
              |||||||||||||||||||||
Sbjct: 306886 ctaacaccatgattttatatg 306906
to top
>emb|AJ418370.1|MTR418370 Medicago truncatula nork gene for nodulation receptor kinase, exons
            1-15, Allele: wild type; NN1
          Length = 8569

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 4714 gccaaaatatctggaaataaa 4694
to top
>gb|AC010422.7| Homo sapiens chromosome 19 clone CTD-2192J16, complete sequence
          Length = 203790

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 228    tggaaataaagaaaaatcctg 248
              |||||||||||||||||||||
Sbjct: 115023 tggaaataaagaaaaatcctg 115003
to top
>dbj|AK124780.1| Homo sapiens cDNA FLJ42790 fis, clone BRAWH3007455
          Length = 3898

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 228 tggaaataaagaaaaatcctg 248
           |||||||||||||||||||||
Sbjct: 693 tggaaataaagaaaaatcctg 673
to top
>gb|AY676457.1| Medicago littoralis genotype L000558 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4135

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2856 gccaaaatatctggaaataaa 2836
to top
>gb|AY676456.1| Medicago truncatula var. tricycla genotype L000540 nodulation
            receptor kinase gene, exons 2 through 11 and partial cds
          Length = 4135

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2856 gccaaaatatctggaaataaa 2836
to top
>gb|AY676455.1| Medicago truncatula genotype L000550 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676454.1| Medicago truncatula genotype L000536 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676453.1| Medicago truncatula genotype L000535 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4128

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676452.1| Medicago truncatula genotype L000551 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676451.1| Medicago truncatula genotype L000554 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676450.1| Medicago truncatula genotype L000549 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676449.1| Medicago truncatula genotype L000548 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676448.1| Medicago truncatula genotype L000547 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676447.1| Medicago truncatula genotype L000545 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676446.1| Medicago truncatula genotype L000543 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676445.1| Medicago truncatula genotype L000529 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676444.1| Medicago truncatula genotype L000537 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676443.1| Medicago truncatula genotype L000651 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676442.1| Medicago truncatula genotype L000648 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676441.1| Medicago truncatula genotype L000534 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4128

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676440.1| Medicago truncatula genotype L000557 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676439.1| Medicago truncatula genotype L000555 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676438.1| Medicago truncatula genotype L000552 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676437.1| Medicago truncatula genotype L000553 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676436.1| Medicago truncatula genotype L000544 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676435.1| Medicago truncatula genotype L000736 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676434.1| Medicago truncatula genotype L000734 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676433.1| Medicago truncatula genotype L000542 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AY676432.1| Medicago truncatula genotype L000538 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676431.1| Medicago truncatula genotype L000527 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676430.1| Medicago truncatula genotype L000531 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676429.1| Medicago truncatula genotype L000530 nodulation receptor kinase gene,
            exons 2 through 11 and partial cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2855 gccaaaatatctggaaataaa 2835
to top
>gb|AY676428.1| Medicago truncatula cultivar Jemalong A17 nodulation receptor kinase
            gene, exons 2 through 11 and partial cds
          Length = 4071

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 2797 gccaaaatatctggaaataaa 2777
to top
>gb|AC004080.2| Homo sapiens PAC clone RP1-170O19 from 7p15-p21, complete sequence
          Length = 129355

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 40    gttaatttgtccctttgttga 60
             |||||||||||||||||||||
Sbjct: 64080 gttaatttgtccctttgttga 64100
to top
>gb|AC024951.31| Homo sapiens chromosome 8 clone RP11-104C10, complete sequence
          Length = 170023

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   tggaaataaagaaaaatcctg 248
             |||||||||||||||||||||
Sbjct: 68858 tggaaataaagaaaaatcctg 68838
to top
>gb|AC153983.7| Mus musculus 6 BAC RP24-479J14 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 178303

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 311    cccaacaagagcagacagtag 331
              |||||||||||||||||||||
Sbjct: 163779 cccaacaagagcagacagtag 163799
to top
>gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, complete sequence
          Length = 186063

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 228    tggaaataaagaaaaatcctg 248
              |||||||||||||||||||||
Sbjct: 122012 tggaaataaagaaaaatcctg 121992
to top
>emb|AJ884582.1| Medicago sativa subsp. coerulea partial nork gene for nodulation
            receptor kinase, exons 2-4 and 7-9
          Length = 1989

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  gccaaaatatctggaaataaa 237
            |||||||||||||||||||||
Sbjct: 1797 gccaaaatatctggaaataaa 1777
to top
>gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, complete sequence
          Length = 196761

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   aatatctggaaataaagaaaaatc 245
             |||||||||||| |||||||||||
Sbjct: 45894 aatatctggaaagaaagaaaaatc 45871
to top
>gb|AC093953.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OJ1057_C01,
              complete sequence
          Length = 142752

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 223    atatctggaaataaagaaaa 242
              ||||||||||||||||||||
Sbjct: 122976 atatctggaaataaagaaaa 122957
to top
>gb|AC140465.2| Mus musculus BAC clone RP24-389J3 from chromosome 16, complete sequence
          Length = 189550

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 221    aaatatctggaaataaagaaaaat 244
              |||||||||||| |||||||||||
Sbjct: 167717 aaatatctggaactaaagaaaaat 167740
to top
>gb|AC145760.3| Microcebus murinus clone CH257-514K9, complete sequence
          Length = 271789

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 205    ttcatcaaccatgccaaaat 224
              ||||||||||||||||||||
Sbjct: 229970 ttcatcaaccatgccaaaat 229951
to top
>gb|U64841.1| Caenorhabditis elegans cosmid ZC142, complete sequence
          Length = 13481

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 23   tcatgaaaacaatcacagtt 42
            ||||||||||||||||||||
Sbjct: 7197 tcatgaaaacaatcacagtt 7216
to top
>gb|AC133604.3| Mus musculus BAC clone RP23-416F12 from chromosome 8, complete sequence
          Length = 221603

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 225    atctggaaataaagaaaaat 244
              ||||||||||||||||||||
Sbjct: 118506 atctggaaataaagaaaaat 118525
to top
>gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete sequence
          Length = 113744

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   ggcgtggtttggttgaatca 267
             ||||||||||||||||||||
Sbjct: 91748 ggcgtggtttggttgaatca 91729
to top
>emb|AL356122.9| Human DNA sequence from clone RP11-61P22 on chromosome 6 Contains part
             of the RNAH gene for an RNA helicase, complete sequence
          Length = 72855

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   tttctggtatagtgaatacc 312
             ||||||||||||||||||||
Sbjct: 70040 tttctggtatagtgaatacc 70059
to top
>gb|AC153760.3| Loxodonta africana clone VMRC15-151E6, complete sequence
          Length = 130127

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 205   ttcatcaaccatgccaaaat 224
             ||||||||||||||||||||
Sbjct: 58568 ttcatcaaccatgccaaaat 58549
to top
>gb|AC104334.2| Homo sapiens chromosome 1 clone RP11-411H5, complete sequence
          Length = 129880

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    tacatcctctttattttcag 84
             ||||||||||||||||||||
Sbjct: 75564 tacatcctctttattttcag 75545
to top
>gb|AC131664.3| Mus musculus BAC clone RP23-274J16 from chromosome 5, complete sequence
          Length = 189996

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    aaccatgccaaaatatctgg 230
              ||||||||||||||||||||
Sbjct: 119553 aaccatgccaaaatatctgg 119572
to top
>gb|AC004155.1|AC004155 Mus musculus DNA from BAC 10818 containing the Ercc-4 gene, complete
             sequence
          Length = 128026

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 221   aaatatctggaaataaagaaaaat 244
             |||||||||||| |||||||||||
Sbjct: 14048 aaatatctggaactaaagaaaaat 14071
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 223      atatctggaaataaagaaaa 242
                ||||||||||||||||||||
Sbjct: 13439513 atatctggaaataaagaaaa 13439494
to top
>gb|AC020611.15| Homo sapiens 12 BAC RP11-1029F8 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 188972

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     ataatgtcccccttctcttc 24
             ||||||||||||||||||||
Sbjct: 16250 ataatgtcccccttctcttc 16231
to top
>emb|BX005279.12| Mouse DNA sequence from clone RP23-321B15 on chromosome X, complete
             sequence
          Length = 222627

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   aatatctggaaataaagaaaaatc 245
             |||||||||||||| |||||||||
Sbjct: 51537 aatatctggaaatacagaaaaatc 51560
to top
>gb|AC159248.4| Mus musculus BAC clone RP24-254P11 from chromosome 16, complete
             sequence
          Length = 172440

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 221   aaatatctggaaataaagaaaaat 244
             |||||||||||| |||||||||||
Sbjct: 89109 aaatatctggaactaaagaaaaat 89086
to top
>emb|AL929457.12| Zebrafish DNA sequence from clone CH211-153I8 in linkage group 14,
              complete sequence
          Length = 164299

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 289    gtcttttctggtatagtgaa 308
              ||||||||||||||||||||
Sbjct: 121200 gtcttttctggtatagtgaa 121181
to top
>gb|AC005279.1|AC005279 Homo sapiens chromosome 17, clone hRPK.103_M_22, complete sequence
          Length = 151429

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   tgattttatatgcactaacc 178
             ||||||||||||||||||||
Sbjct: 74446 tgattttatatgcactaacc 74427
to top
>emb|BX510330.20| Zebrafish DNA sequence from clone DKEYP-82B3 in linkage group 13,
             complete sequence
          Length = 96887

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   gtcttttctggtatagtgaa 308
             ||||||||||||||||||||
Sbjct: 17514 gtcttttctggtatagtgaa 17495
to top
>gb|DP000022.1| Microcebus murinus target 1 genomic scaffold
          Length = 1595145

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 205     ttcatcaaccatgccaaaat 224
               ||||||||||||||||||||
Sbjct: 1104426 ttcatcaaccatgccaaaat 1104407
to top
>gb|AY067606.1| Schmidtea mediterranea clone H.37.3e unknown mRNA sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 220 aaaatatctggaaataaaga 239
           ||||||||||||||||||||
Sbjct: 85  aaaatatctggaaataaaga 66


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,163,725
Number of Sequences: 3902068
Number of extensions: 4163725
Number of successful extensions: 86662
Number of sequences better than 10.0: 73
Number of HSP's better than 10.0 without gapping: 73
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86496
Number of HSP's gapped (non-prelim): 166
length of query: 360
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 338
effective length of database: 17,147,199,772
effective search space: 5795753522936
effective search space used: 5795753522936
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top