ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl53e04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC023590.8| Homo sapiens chromosome 8, clone RP11-655M22, com... 42 0.62
2gb|AC129065.3| Didelphis virginiana clone LB3-118L8, complete se... 42 0.62
3gb|DP000023.1| Didelphis virginiana target 1 genomic scaffold 42 0.62
4dbj|AP003493.1| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 0.62
5gb|DQ452068.1| Homo sapiens lipoprotein, Lp(a) (LPA) gene, compl... 40 2.4
6ref|NM_005577.1| Homo sapiens lipoprotein, Lp(a) (LPA), mRNA 40 2.4
7gb|DQ132680.1| Arabidopsis thaliana clone 01672 expressed protei... 40 2.4
8gb|DQ132679.1| Arabidopsis thaliana clone 01671 expressed protei... 40 2.4
9gb|DQ132678.1| Arabidopsis thaliana clone 01670 expressed protei... 40 2.4
10emb|AL596089.19| Human DNA sequence from clone RP11-414A5 on chr... 40 2.4
11gb|AC112693.5| Homo sapiens chromosome 15, clone RP11-326A13, co... 40 2.4
12gb|AC023114.5| Homo sapiens BAC clone RP11-266O8 from 15, comple... 40 2.4
13gb|AC012563.7|AC012563 Arabidopsis thaliana chromosome 1 BAC T23... 40 2.4
14gb|U12980.3|SCU12980 Saccharomyces cerevisiae chromosome I left ... 40 2.4
15gb|M86882.1|HUMPGRKRRD H.sapiens plasminogen-apolipoprotein (a) ... 40 2.4
16gb|M86881.1|HUMPGRKRRC H.sapiens plasminogen-apolipoprotein (a) ... 40 2.4
17emb|X06290.1|HSALIPOA Human mRNA for apolipoprotein(a) 40 2.4
18gb|AC111113.17| Mus musculus chromosome 1, clone RP23-205B8, com... 38 9.7
19emb|CT009553.4| M.truncatula DNA sequence from clone MTH2-115C19... 38 9.7
20gb|AY247121.1| Ropalidia revolutionalis microsatellite Rrev250 s... 38 9.7
21gb|AC123695.10| Mus musculus chromosome 15, clone RP23-328C23, c... 38 9.7
22emb|AL158157.8| Human DNA sequence from clone RP11-413D24 on chr... 38 9.7
23emb|AL844142.5| Mouse DNA sequence from clone RP23-355C24 on chr... 38 9.7
24gb|AC013701.6| Homo sapiens, clone RP11-22C8, complete sequence 38 9.7
25gb|AC104627.8| Drosophila melanogaster X BAC RP98-4A11 (Roswell ... 38 9.7
26gb|AC016398.6| Homo sapiens chromosome 10 clone RP11-561G1, comp... 38 9.7
27gb|AC159018.3| Pan troglodytes BAC clone CH251-533F3 from chromo... 38 9.7
28gb|AC121569.4| Mus musculus BAC clone RP23-228C13 from chromosom... 38 9.7
29gb|CP000033.1| Lactobacillus acidophilus NCFM, complete genome 38 9.7
30gb|AE003490.3| Drosophila melanogaster chromosome X, section 42 ... 38 9.7
31gb|AC124991.14| Mus musculus chromosome 12, clone RP23-138M19, c... 38 9.7
32gb|AC161420.6| Mus musculus BAC clone RP24-358O9 from chromosome... 38 9.7
33gb|AC172195.2| Rhesus Macaque BAC CH250-403C24 (Children's Hosp... 38 9.7

>gb|AC023590.8| Homo sapiens chromosome 8, clone RP11-655M22, complete sequence
          Length = 175582

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 44     tggtggagtaaaccagtcaaa 64
              |||||||||||||||||||||
Sbjct: 122493 tggtggagtaaaccagtcaaa 122473



to top

>gb|AC129065.3| Didelphis virginiana clone LB3-118L8, complete sequence
          Length = 166731

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 133    tcctgtacgctcccctgagta 153
              |||||||||||||||||||||
Sbjct: 156642 tcctgtacgctcccctgagta 156662



to top

>gb|DP000023.1| Didelphis virginiana target 1 genomic scaffold
          Length = 1751794

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 133     tcctgtacgctcccctgagta 153
               |||||||||||||||||||||
Sbjct: 1741705 tcctgtacgctcccctgagta 1741725



to top

>dbj|AP003493.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1065F11
          Length = 156580

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 44     tggtggagtaaaccagtcaaa 64
              |||||||||||||||||||||
Sbjct: 101893 tggtggagtaaaccagtcaaa 101913



to top

>gb|DQ452068.1| Homo sapiens lipoprotein, Lp(a) (LPA) gene, complete cds
          Length = 136345

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ccagtgacagtggtggagta 53
             ||||||||||||||||||||
Sbjct: 55625 ccagtgacagtggtggagta 55606



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ccagtgacagtggtggagta 53
             ||||||||||||||||||||
Sbjct: 33434 ccagtgacagtggtggagta 33415



to top

>ref|NM_005577.1| Homo sapiens lipoprotein, Lp(a) (LPA), mRNA
          Length = 13938

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ccagtgacagtggtggagta 53
             ||||||||||||||||||||
Sbjct: 10100 ccagtgacagtggtggagta 10081



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ccagtgacagtggtggagta 53
            ||||||||||||||||||||
Sbjct: 9758 ccagtgacagtggtggagta 9739



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ccagtgacagtggtggagta 53
            ||||||||||||||||||||
Sbjct: 9416 ccagtgacagtggtggagta 9397



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ccagtgacagtggtggagta 53
            ||||||||||||||||||||
Sbjct: 9074 ccagtgacagtggtggagta 9055



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ccagtgacagtggtggagta 53
            ||||||||||||||||||||
Sbjct: 8048 ccagtgacagtggtggagta 8029



to top

>gb|DQ132680.1| Arabidopsis thaliana clone 01672 expressed protein (At1g68080) mRNA,
            complete cds
          Length = 1276

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 60   tcaaagaacagctactcaattatc 83
            ||||||||||||| ||||||||||
Sbjct: 1149 tcaaagaacagcttctcaattatc 1172



to top

>gb|DQ132679.1| Arabidopsis thaliana clone 01671 expressed protein (At1g68080) mRNA,
            complete cds
          Length = 1353

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 60   tcaaagaacagctactcaattatc 83
            ||||||||||||| ||||||||||
Sbjct: 1216 tcaaagaacagcttctcaattatc 1239



to top

>gb|DQ132678.1| Arabidopsis thaliana clone 01670 expressed protein (At1g68080) mRNA,
            complete cds
          Length = 1489

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 60   tcaaagaacagctactcaattatc 83
            ||||||||||||| ||||||||||
Sbjct: 1352 tcaaagaacagcttctcaattatc 1375



to top

>emb|AL596089.19| Human DNA sequence from clone RP11-414A5 on chromosome 6 Contains the 3'
              end of the LPA gene for lipoprotein (Lp(a)) and a CpG
              island, complete sequence
          Length = 135751

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ccagtgacagtggtggagta 53
              ||||||||||||||||||||
Sbjct: 117542 ccagtgacagtggtggagta 117561



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ccagtgacagtggtggagta 53
             ||||||||||||||||||||
Sbjct: 95351 ccagtgacagtggtggagta 95370



to top

>gb|AC112693.5| Homo sapiens chromosome 15, clone RP11-326A13, complete sequence
          Length = 136130

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 49    gagtaaaccagtcaaagaacagctactc 76
             ||||||| |||| |||||||||||||||
Sbjct: 21316 gagtaaagcagtgaaagaacagctactc 21289



to top

>gb|AC023114.5| Homo sapiens BAC clone RP11-266O8 from 15, complete sequence
          Length = 164242

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 49    gagtaaaccagtcaaagaacagctactc 76
             ||||||| |||| |||||||||||||||
Sbjct: 75535 gagtaaagcagtgaaagaacagctactc 75562



to top

>gb|AC012563.7|AC012563 Arabidopsis thaliana chromosome 1 BAC T23K23 genomic sequence, complete
             sequence
          Length = 101966

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 60    tcaaagaacagctactcaattatc 83
             ||||||||||||| ||||||||||
Sbjct: 25087 tcaaagaacagcttctcaattatc 25064



to top

>gb|U12980.3|SCU12980 Saccharomyces cerevisiae chromosome I left arm sequence
          Length = 103681

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    ccattagtgccagtgacagt 44
             ||||||||||||||||||||
Sbjct: 10692 ccattagtgccagtgacagt 10711



to top

>gb|M86882.1|HUMPGRKRRD H.sapiens plasminogen-apolipoprotein (a) gene family, exon for 30th
           kringle 4 repeat
          Length = 219

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ccagtgacagtggtggagta 53
           ||||||||||||||||||||
Sbjct: 117 ccagtgacagtggtggagta 98



to top

>gb|M86881.1|HUMPGRKRRC H.sapiens plasminogen-apolipoprotein (a) gene family, exon for B
           type kringle 4 repeat
          Length = 219

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  ccagtgacagtggtggagta 53
           ||||||||||||||||||||
Sbjct: 117 ccagtgacagtggtggagta 98



to top

>emb|X06290.1|HSALIPOA Human mRNA for apolipoprotein(a)
          Length = 13938

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ccagtgacagtggtggagta 53
             ||||||||||||||||||||
Sbjct: 10100 ccagtgacagtggtggagta 10081



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ccagtgacagtggtggagta 53
            ||||||||||||||||||||
Sbjct: 9758 ccagtgacagtggtggagta 9739



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ccagtgacagtggtggagta 53
            ||||||||||||||||||||
Sbjct: 9416 ccagtgacagtggtggagta 9397



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ccagtgacagtggtggagta 53
            ||||||||||||||||||||
Sbjct: 9074 ccagtgacagtggtggagta 9055



 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   ccagtgacagtggtggagta 53
            ||||||||||||||||||||
Sbjct: 8048 ccagtgacagtggtggagta 8029



to top

>gb|AC111113.17| Mus musculus chromosome 1, clone RP23-205B8, complete sequence
          Length = 201485

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 32     tgccagtgacagtggtgga 50
              |||||||||||||||||||
Sbjct: 104362 tgccagtgacagtggtgga 104380



to top

>emb|CT009553.4| M.truncatula DNA sequence from clone MTH2-115C19 on chromosome 3,
             complete sequence
          Length = 125987

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 73    actcaattatcatcttaaa 91
             |||||||||||||||||||
Sbjct: 52090 actcaattatcatcttaaa 52108



to top

>gb|AY247121.1| Ropalidia revolutionalis microsatellite Rrev250 sequence
          Length = 530

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  tcatcttaaacccttcatt 100
           |||||||||||||||||||
Sbjct: 50  tcatcttaaacccttcatt 32



to top

>gb|AC123695.10| Mus musculus chromosome 15, clone RP23-328C23, complete sequence
          Length = 217334

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     gaccaacaaaagcataaca 21
             |||||||||||||||||||
Sbjct: 51083 gaccaacaaaagcataaca 51065



to top

>emb|AL158157.8| Human DNA sequence from clone RP11-413D24 on chromosome 9, complete
             sequence
          Length = 183410

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    aattatcatcttaaaccct 95
             |||||||||||||||||||
Sbjct: 69138 aattatcatcttaaaccct 69120



to top

>emb|AL844142.5| Mouse DNA sequence from clone RP23-355C24 on chromosome 4, complete
            sequence
          Length = 121550

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 176  gcaaaccaaaaagaagcac 194
            |||||||||||||||||||
Sbjct: 2691 gcaaaccaaaaagaagcac 2709



to top

>gb|AC013701.6| Homo sapiens, clone RP11-22C8, complete sequence
          Length = 160275

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    tccattagtgccagtgaca 42
             |||||||||||||||||||
Sbjct: 87423 tccattagtgccagtgaca 87441



to top

>gb|AC104627.8| Drosophila melanogaster X BAC RP98-4A11 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 187921

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 164    aatccaaggggggcaaacc 182
              |||||||||||||||||||
Sbjct: 101982 aatccaaggggggcaaacc 101964



to top

>gb|AC016398.6| Homo sapiens chromosome 10 clone RP11-561G1, complete sequence
          Length = 158817

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 157   tcgccataatccaaggggggcaaacca 183
             |||||||||||| || |||||||||||
Sbjct: 63251 tcgccataatcctagaggggcaaacca 63277



to top

>gb|AC159018.3| Pan troglodytes BAC clone CH251-533F3 from chromosome unknown, complete
              sequence
          Length = 179366

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 46     gtggagtaaaccagtcaaa 64
              |||||||||||||||||||
Sbjct: 147128 gtggagtaaaccagtcaaa 147110



to top

>gb|AC121569.4| Mus musculus BAC clone RP23-228C13 from chromosome 12, complete
             sequence
          Length = 171710

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 171   ggggggcaaaccaaaaagaagca 193
             ||||||||||||||| |||||||
Sbjct: 87653 ggggggcaaaccaaatagaagca 87631



to top

>gb|CP000033.1| Lactobacillus acidophilus NCFM, complete genome
          Length = 1993564

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     tatcatcttaaacccttca 98
              |||||||||||||||||||
Sbjct: 775810 tatcatcttaaacccttca 775792



to top

>gb|AE003490.3| Drosophila melanogaster chromosome X, section 42 of 74 of the complete
              sequence
          Length = 302665

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 164    aatccaaggggggcaaacc 182
              |||||||||||||||||||
Sbjct: 183553 aatccaaggggggcaaacc 183535



to top

>gb|AC124991.14| Mus musculus chromosome 12, clone RP23-138M19, complete sequence
          Length = 179111

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 171   ggggggcaaaccaaaaagaagca 193
             ||||||||||||||| |||||||
Sbjct: 85334 ggggggcaaaccaaatagaagca 85312



to top

>gb|AC161420.6| Mus musculus BAC clone RP24-358O9 from chromosome 1, complete sequence
          Length = 200763

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 32    tgccagtgacagtggtgga 50
             |||||||||||||||||||
Sbjct: 56266 tgccagtgacagtggtgga 56284



to top

>gb|AC172195.2| Rhesus Macaque  BAC CH250-403C24 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 152893

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     gtggagtaaaccagtcaaa 64
              |||||||||||||||||||
Sbjct: 108845 gtggagtaaaccagtcaaa 108863


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,567,605
Number of Sequences: 3902068
Number of extensions: 1567605
Number of successful extensions: 106093
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 105926
Number of HSP's gapped (non-prelim): 167
length of query: 195
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 173
effective length of database: 17,147,199,772
effective search space: 2966465560556
effective search space used: 2966465560556
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top