ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl53d08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_948594.1| Theileria annulata strain Ankara elongation fac... 42 0.53
2dbj|AP000787.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 0.53
3gb|AY253318.1| HIV-1 isolate 01TZA306 from Tanzania gag protein ... 40 2.1
4emb|CT030572.1| Xenopus tropicalis finished cDNA, clone TNeu071k23 40 2.1
5gb|AC130891.4| Homo sapiens 12 BAC RP11-97F22 (Roswell Park Canc... 40 2.1
6emb|X94357.1|SCHRVIILT S.cerevisiae left telomeric region from c... 40 2.1
7emb|X67787.1|SCFZF1 S.cerevisiae FZF1, HXK2 genes and ORF1 for z... 40 2.1
8gb|AC140121.4| Homo sapiens 12 BAC RP13-86N24 (Roswell Park Canc... 40 2.1
9gb|AY463223.1| HIV-1 isolate C.ZA.J54Ma from South Africa, compl... 40 2.1
10gb|AC153967.5| Mus musculus 10 BAC RP24-372A5 (Roswell Park Canc... 40 2.1
11gb|DQ011177.1| HIV-1 isolate 04ZASK136B1 from South Africa, comp... 40 2.1
12gb|DQ011166.1| HIV-1 isolate 04ZASK135B1 from South Africa, comp... 40 2.1
13gb|AY713414.1| HIV-1 isolate 94IN_20635-4 from India gag protein... 40 2.1
14gb|DQ351226.1| HIV-1 isolate 03ZAPS025MB1 from South Africa, com... 40 2.1
15emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 i... 40 2.1
16emb|Z72777.1|SCYGL255W S.cerevisiae chromosome VII reading frame... 40 2.1
17gb|AC133511.3| Mus musculus BAC clone RP23-413E2 from 10, comple... 40 2.1
18gb|AY703908.1| HIV-1 isolate 03ZASK040B1 from South Africa, comp... 38 8.3
19gb|DQ396396.1| HIV-1 isolate 04ZASK193B1 from South Africa, comp... 38 8.3
20gb|DQ396391.1| HIV-1 isolate 03ZAPS143MB1 from South Africa, com... 38 8.3
21gb|AC011288.4| Homo sapiens BAC clone RP11-27B1 from 7, complete... 38 8.3
22gb|AC142355.1| Pan troglodytes BAC clone RP43-22I16 from 7, comp... 38 8.3
23emb|AL158195.11| Human DNA sequence from clone RP11-48H1 on chro... 38 8.3
24emb|CR450789.9| Zebrafish DNA sequence from clone DKEY-7P12 in l... 38 8.3
25gb|AY463220.1| HIV-1 isolate C.ZA.1195MB from South Africa, comp... 38 8.3
26gb|AF443115.1| HIV-1 isolate 00BW5031.1 from Botswana, complete ... 38 8.3
27gb|AF440620.1|AF440620 Homo sapiens 13q14 chronic lymphocytic le... 38 8.3
28gb|AF361874.1|AF361874 HIV-1 isolate 97TZ04 from Tanzania trunca... 38 8.3
29gb|AY901971.1| HIV-1 isolate 03ZASK078B1 from South Africa, comp... 38 8.3
30gb|DQ275646.1| HIV-1 isolate 03ZAPS133MB1 from South Africa gag ... 38 8.3
31gb|DQ369977.1| HIV-1 isolate 03ZAPS042MB1 from South Africa, com... 38 8.3
32gb|AC005949.12| Homo sapiens chromosome 13 clone 468p13 map 13q1... 38 8.3
33gb|AC005948.14| Homo sapiens chromosome 13 clone 460f10 map 13q1... 38 8.3
34gb|AC009492.4| Homo sapiens BAC clone RP11-423F9 from 2, complet... 38 8.3
35gb|DQ351222.1| HIV-1 isolate 02ZAPS013MB1 from South Africa, com... 38 8.3
36gb|AC115771.13| Mus musculus chromosome 19, clone RP23-116D4, co... 38 8.3
37gb|AE015927.1| Clostridium tetani E88, complete genome 38 8.3
38gb|AC126054.5| Mus musculus BAC clone RP23-298O13 from 8, comple... 38 8.3
39gb|AC127291.4| Mus musculus BAC clone RP23-365H24 from 8, comple... 38 8.3
40emb|AL627328.17| Mouse DNA sequence from clone RP23-299J22 on ch... 38 8.3 
>ref|XM_948594.1| Theileria annulata strain Ankara elongation factor 2 (TA16255)
            partial mRNA
          Length = 3681

 Score = 42.1 bits (21), Expect = 0.53
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 78   tagttattattctccagggcgtcaa 102
            |||| ||||||||||||||||||||
Sbjct: 3193 tagtcattattctccagggcgtcaa 3169
to top
>dbj|AP000787.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-712B9, complete
             sequence
          Length = 173441

 Score = 42.1 bits (21), Expect = 0.53
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 61    ataaaatcatataccagtagt 81
             |||||||||||||||||||||
Sbjct: 58939 ataaaatcatataccagtagt 58919
to top
>gb|AY253318.1| HIV-1 isolate 01TZA306 from Tanzania gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8737

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 133  tttctctagctgaaacaaca 152
            ||||||||||||||||||||
Sbjct: 3127 tttctctagctgaaacaaca 3146
to top
>emb|CT030572.1| Xenopus tropicalis finished cDNA, clone TNeu071k23
          Length = 1750

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 54  ctttgatataaaatcatata 73
           ||||||||||||||||||||
Sbjct: 762 ctttgatataaaatcatata 781
to top
>gb|AC130891.4| Homo sapiens 12 BAC RP11-97F22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 32143

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    ccagtagttattattctcca 93
             ||||||||||||||||||||
Sbjct: 19111 ccagtagttattattctcca 19130
to top
>emb|X94357.1|SCHRVIILT S.cerevisiae left telomeric region from chromosome VII
          Length = 39411

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    tcaaaaaaggaattatgagc 118
             ||||||||||||||||||||
Sbjct: 20964 tcaaaaaaggaattatgagc 20983
to top
>emb|X67787.1|SCFZF1 S.cerevisiae FZF1, HXK2 genes and ORF1 for zinc finger protein and
           hexokinase PII
          Length = 4430

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 99  tcaaaaaaggaattatgagc 118
           ||||||||||||||||||||
Sbjct: 716 tcaaaaaaggaattatgagc 735
to top
>gb|AC140121.4| Homo sapiens 12 BAC RP13-86N24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 39373

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    ccagtagttattattctcca 93
             ||||||||||||||||||||
Sbjct: 19842 ccagtagttattattctcca 19823
to top
>gb|AY463223.1| HIV-1 isolate C.ZA.J54Ma from South Africa, complete genome
          Length = 9117

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 125  aaagattttttctctagctgaaacaaca 152
            ||||||| |||||||| |||||||||||
Sbjct: 3366 aaagattgtttctctaactgaaacaaca 3393
to top
>gb|AC153967.5| Mus musculus 10 BAC RP24-372A5 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 205657

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 63     aaaatcatataccagtagtt 82
              ||||||||||||||||||||
Sbjct: 141192 aaaatcatataccagtagtt 141211
to top
>gb|DQ011177.1| HIV-1 isolate 04ZASK136B1 from South Africa, complete genome
          Length = 9042

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 133  tttctctagctgaaacaaca 152
            ||||||||||||||||||||
Sbjct: 3367 tttctctagctgaaacaaca 3386
to top
>gb|DQ011166.1| HIV-1 isolate 04ZASK135B1 from South Africa, complete genome
          Length = 9073

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 133  tttctctagctgaaacaaca 152
            ||||||||||||||||||||
Sbjct: 3340 tttctctagctgaaacaaca 3359
to top
>gb|AY713414.1| HIV-1 isolate 94IN_20635-4 from India gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8745

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 125  aaagattttttctctagctgaaacaaca 152
            ||||||| |||||||| |||||||||||
Sbjct: 3119 aaagattgtttctctaactgaaacaaca 3146
to top
>gb|DQ351226.1| HIV-1 isolate 03ZAPS025MB1 from South Africa, complete genome
          Length = 9081

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 125  aaagattttttctctagctgaaacaaca 152
            ||||||| |||||||| |||||||||||
Sbjct: 3352 aaagattgtttctctaactgaaacaaca 3379
to top
>emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 in linkage group 20,
              complete sequence
          Length = 163231

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 57     tgatataaaatcatatacca 76
              ||||||||||||||||||||
Sbjct: 115172 tgatataaaatcatatacca 115153
to top
>emb|Z72777.1|SCYGL255W S.cerevisiae chromosome VII reading frame ORF YGL255w
          Length = 5996

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 99   tcaaaaaaggaattatgagc 118
            ||||||||||||||||||||
Sbjct: 4657 tcaaaaaaggaattatgagc 4676
to top
>gb|AC133511.3| Mus musculus BAC clone RP23-413E2 from 10, complete sequence
          Length = 214377

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    aaaatcatataccagtagtt 82
             ||||||||||||||||||||
Sbjct: 96152 aaaatcatataccagtagtt 96171
to top
>gb|AY703908.1| HIV-1 isolate 03ZASK040B1 from South Africa, complete genome
          Length = 9020

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3357 aagattgtttctctaactgaaacaaca 3383
to top
>gb|DQ396396.1| HIV-1 isolate 04ZASK193B1 from South Africa, complete genome
          Length = 9083

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3372 aagattgtttctctaactgaaacaaca 3398
to top
>gb|DQ396391.1| HIV-1 isolate 03ZAPS143MB1 from South Africa, complete genome
          Length = 9075

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3359 aagattgtttctctaactgaaacaaca 3385
to top
>gb|AC011288.4| Homo sapiens BAC clone RP11-27B1 from 7, complete sequence
          Length = 159722

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    tttgatataaaatcatata 73
             |||||||||||||||||||
Sbjct: 14621 tttgatataaaatcatata 14603
to top
>gb|AC142355.1| Pan troglodytes BAC clone RP43-22I16 from 7, complete sequence
          Length = 192927

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 55     tttgatataaaatcatata 73
              |||||||||||||||||||
Sbjct: 184344 tttgatataaaatcatata 184326
to top
>emb|AL158195.11| Human DNA sequence from clone RP11-48H1 on chromosome 13 Contains part
             of the DLEU1 gene for deleted in lymphocytic leukemia 1
             (BCMS LEU1), complete sequence
          Length = 123209

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    tttgatataaaatcatata 73
             |||||||||||||||||||
Sbjct: 86377 tttgatataaaatcatata 86359
to top
>emb|CR450789.9| Zebrafish DNA sequence from clone DKEY-7P12 in linkage group 8, complete
              sequence
          Length = 144569

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 68     catataccagtagttattattct 90
              ||||||||| |||||||||||||
Sbjct: 118539 catataccattagttattattct 118517
to top
>gb|AY463220.1| HIV-1 isolate C.ZA.1195MB from South Africa, complete genome
          Length = 9105

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3372 aagattgtttctctaactgaaacaaca 3398
to top
>gb|AF443115.1| HIV-1 isolate 00BW5031.1 from Botswana, complete genome
          Length = 9047

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3313 aagattgtttctctaactgaaacaaca 3339
to top
>gb|AF440620.1|AF440620 Homo sapiens 13q14 chronic lymphocytic leukemia suppressor locus section
              2 of 2
          Length = 440917

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 55     tttgatataaaatcatata 73
              |||||||||||||||||||
Sbjct: 165078 tttgatataaaatcatata 165060
to top
>gb|AF361874.1|AF361874 HIV-1 isolate 97TZ04 from Tanzania truncated gag protein (gag),
            partial cds; and pol protein (pol), vif protein (vif),
            vpr protein (vpr), truncated tat protein (tat), truncated
            rev protein (rev), vpu protein (vpu), envelope
            glycoprotein (env), and nef protein (nef) genes, complete
            cds
          Length = 8834

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| || |||||||||||||||||
Sbjct: 3137 aagattgttactctagctgaaacaaca 3163
to top
>gb|AY901971.1| HIV-1 isolate 03ZASK078B1 from South Africa, complete genome
          Length = 9121

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3371 aagattgtttctctaactgaaacaaca 3397
to top
>gb|DQ275646.1| HIV-1 isolate 03ZAPS133MB1 from South Africa gag protein (gag) gene,
            complete cds; pol protein (pol) gene, partial cds; and
            vif protein (vif), vpr protein (vpr), tat protein (tat),
            rev protein (rev), vpu protein (vpu), envelope
            glycoprotein (env), and nef protein (nef) genes, complete
            cds
          Length = 8969

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3352 aagattatttctctaactgaaacaaca 3378
to top
>gb|DQ369977.1| HIV-1 isolate 03ZAPS042MB1 from South Africa, complete genome
          Length = 9015

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3353 aagattgtttctctaactgaaacaaca 3379
to top
>gb|AC005949.12| Homo sapiens chromosome 13 clone 468p13 map 13q14, complete sequence
          Length = 143107

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    tttgatataaaatcatata 73
             |||||||||||||||||||
Sbjct: 54710 tttgatataaaatcatata 54728
to top
>gb|AC005948.14| Homo sapiens chromosome 13 clone 460f10 map 13q14, complete sequence
          Length = 154065

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 55   tttgatataaaatcatata 73
            |||||||||||||||||||
Sbjct: 4867 tttgatataaaatcatata 4885
to top
>gb|AC009492.4| Homo sapiens BAC clone RP11-423F9 from 2, complete sequence
          Length = 212549

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 130   ttttttctctagctgaaac 148
             |||||||||||||||||||
Sbjct: 44443 ttttttctctagctgaaac 44461
to top
>gb|DQ351222.1| HIV-1 isolate 02ZAPS013MB1 from South Africa, complete genome
          Length = 9022

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 126  aagattttttctctagctgaaacaaca 152
            |||||| |||||||| |||||||||||
Sbjct: 3355 aagattatttctctaactgaaacaaca 3381
to top
>gb|AC115771.13| Mus musculus chromosome 19, clone RP23-116D4, complete sequence
          Length = 209515

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 70     tataccagtagttattatt 88
              |||||||||||||||||||
Sbjct: 130495 tataccagtagttattatt 130513
to top
>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 129    attttttctctagctgaaa 147
              |||||||||||||||||||
Sbjct: 543526 attttttctctagctgaaa 543544
to top
>gb|AC126054.5| Mus musculus BAC clone RP23-298O13 from 8, complete sequence
          Length = 233117

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 134   ttctctagctgaaacaaca 152
             |||||||||||||||||||
Sbjct: 85966 ttctctagctgaaacaaca 85984
to top
>gb|AC127291.4| Mus musculus BAC clone RP23-365H24 from 8, complete sequence
          Length = 208452

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 67     tcatataccagtagttatt 85
              |||||||||||||||||||
Sbjct: 154747 tcatataccagtagttatt 154729
to top
>emb|AL627328.17| Mouse DNA sequence from clone RP23-299J22 on chromosome 4, complete
             sequence
          Length = 229494

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 44    cacaagccggctttgatat 62
             |||||||||||||||||||
Sbjct: 62344 cacaagccggctttgatat 62326


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,020,895
Number of Sequences: 3902068
Number of extensions: 2020895
Number of successful extensions: 130975
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 130845
Number of HSP's gapped (non-prelim): 130
length of query: 170
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 148
effective length of database: 17,147,199,772
effective search space: 2537785566256
effective search space used: 2537785566256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top