ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl53d01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC114987.10| Mus musculus chromosome 3, clone RP23-81D7, comp... 44 0.25
2gb|DQ437743.1| Pseudomonas aeruginosa strain 19660 ExoU Island B... 42 1.0
3gb|AF212132.1| Bombyx mandarina mariner transposon Bmamar2 trans... 42 1.0
4emb|AL929469.10| Zebrafish DNA sequence from clone CH211-149K17 ... 42 1.0
5gb|AC129596.3| Mus musculus BAC clone RP23-261I2 from 1, complet... 42 1.0
6gb|AC167974.3| Mus musculus BAC clone RP23-314B11 from chromosom... 42 1.0
7emb|BX901973.12| Zebrafish DNA sequence from clone DKEY-26L17 in... 40 4.0
8ref|NG_000018.1| Homo sapiens type I (acidic) hair keratin gene ... 40 4.0
9gb|AC090259.5| Homo sapiens chromosome 15, clone RP11-424E9, com... 40 4.0
10gb|AC100825.2| Homo sapiens chromosome 15, clone RP11-1152M12, c... 40 4.0
11gb|AC007318.4| Homo sapiens BAC clone RP11-420C9 from 2, complet... 40 4.0
12gb|AC016370.17|AC016370 Homo sapiens chromosome 15 clone RP11-42... 40 4.0
13gb|AC003958.2| Homo sapiens chromosome 17, clone RP5-18F17, comp... 40 4.0
14gb|AC119189.8| Mus musculus chromosome 1, clone RP24-178E16, com... 40 4.0
15gb|AC160563.2| Ornithorhynchus anatinus BAC clone OABb-456P24 fr... 40 4.0
16gb|AC163695.2| Ornithorhynchus anatinus BAC clone OABb-35L5 from... 40 4.0
17dbj|AP001577.3| Homo sapiens genomic DNA, chromosome 6q25.2, clo... 40 4.0

>gb|AC114987.10| Mus musculus chromosome 3, clone RP23-81D7, complete sequence
          Length = 179717

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 35    taatatattgtaatgctttttt 56
             ||||||||||||||||||||||
Sbjct: 68406 taatatattgtaatgctttttt 68427



to top

>gb|DQ437743.1| Pseudomonas aeruginosa strain 19660 ExoU Island B, complete sequence
          Length = 30407

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 150   aagaacaaaacacgcaacaat 170
             |||||||||||||||||||||
Sbjct: 26187 aagaacaaaacacgcaacaat 26207



to top

>gb|AF212132.1| Bombyx mandarina mariner transposon Bmamar2 transposase pseudogene,
           partial sequence
          Length = 458

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 186 gtcggtaataaagcatcacaattga 210
           ||||||||||||| |||||||||||
Sbjct: 54  gtcggtaataaagaatcacaattga 30



to top

>emb|AL929469.10| Zebrafish DNA sequence from clone CH211-149K17 in linkage group 12,
             complete sequence
          Length = 146415

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    agcatactattaatatattgt 45
             |||||||||||||||||||||
Sbjct: 80947 agcatactattaatatattgt 80967



to top

>gb|AC129596.3| Mus musculus BAC clone RP23-261I2 from 1, complete sequence
          Length = 162998

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 23    tgagcatactattaatatatt 43
             |||||||||||||||||||||
Sbjct: 23581 tgagcatactattaatatatt 23601



to top

>gb|AC167974.3| Mus musculus BAC clone RP23-314B11 from chromosome 1, complete sequence
          Length = 210757

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 23     tgagcatactattaatatatt 43
              |||||||||||||||||||||
Sbjct: 164804 tgagcatactattaatatatt 164824



to top

>emb|BX901973.12| Zebrafish DNA sequence from clone DKEY-26L17 in linkage group 3, complete
              sequence
          Length = 226081

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 51     ttttttattgagtttatatc 70
              ||||||||||||||||||||
Sbjct: 155584 ttttttattgagtttatatc 155603



to top

>ref|NG_000018.1| Homo sapiens type I (acidic) hair keratin gene cluster (KRTHA.1@) on
             chromosome 17
          Length = 100000

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    tactattaatatattgtaat 48
             ||||||||||||||||||||
Sbjct: 96099 tactattaatatattgtaat 96080



to top

>gb|AC090259.5| Homo sapiens chromosome 15, clone RP11-424E9, complete sequence
          Length = 143479

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 195    aaagcatcacaattgatgta 214
              ||||||||||||||||||||
Sbjct: 126939 aaagcatcacaattgatgta 126958



to top

>gb|AC100825.2| Homo sapiens chromosome 15, clone RP11-1152M12, complete sequence
          Length = 127680

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   aaagcatcacaattgatgta 214
             ||||||||||||||||||||
Sbjct: 45044 aaagcatcacaattgatgta 45025



to top

>gb|AC007318.4| Homo sapiens BAC clone RP11-420C9 from 2, complete sequence
          Length = 204230

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    tgcttttttattgagtttat 67
             ||||||||||||||||||||
Sbjct: 64234 tgcttttttattgagtttat 64215



to top

>gb|AC016370.17|AC016370 Homo sapiens chromosome 15 clone RP11-424E9, complete sequence
          Length = 162773

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 195    aaagcatcacaattgatgta 214
              ||||||||||||||||||||
Sbjct: 146233 aaagcatcacaattgatgta 146252



to top

>gb|AC003958.2| Homo sapiens chromosome 17, clone RP5-18F17, complete sequence
          Length = 127833

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    tactattaatatattgtaat 48
             ||||||||||||||||||||
Sbjct: 96098 tactattaatatattgtaat 96079



to top

>gb|AC119189.8| Mus musculus chromosome 1, clone RP24-178E16, complete sequence
          Length = 182530

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 258    agacctatcgtgaaaaggaa 277
              ||||||||||||||||||||
Sbjct: 123743 agacctatcgtgaaaaggaa 123724



to top

>gb|AC160563.2| Ornithorhynchus anatinus BAC clone OABb-456P24 from chromosome unknown,
             complete sequence
          Length = 152763

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 86    tgtgcgtgcttgaatacaat 105
             ||||||||||||||||||||
Sbjct: 71122 tgtgcgtgcttgaatacaat 71141



to top

>gb|AC163695.2| Ornithorhynchus anatinus BAC clone OABb-35L5 from chromosome unknown,
             complete sequence
          Length = 89299

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   agcaattccctagtattagg 139
             ||||||||||||||||||||
Sbjct: 10707 agcaattccctagtattagg 10726



to top

>dbj|AP001577.3| Homo sapiens genomic DNA, chromosome 6q25.2, clone:KB611H5
          Length = 144828

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 239   ttcacccatttatcaagaaa 258
             ||||||||||||||||||||
Sbjct: 43968 ttcacccatttatcaagaaa 43949


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,117,927
Number of Sequences: 3902068
Number of extensions: 3117927
Number of successful extensions: 59682
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59657
Number of HSP's gapped (non-prelim): 25
length of query: 303
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 281
effective length of database: 17,147,199,772
effective search space: 4818363135932
effective search space used: 4818363135932
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top