>emb|AL121761.5|HSJ122P22 Human DNA sequence from clone RP1-122P22 on chromosome 20 Contains the 3'
              end the SLC24A3 gene for solute carrier family 24
              (sodium/potassium/calcium exchanger) member 3, a novel gene
              and a CpG island, complete sequence
          Length = 118990

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 244    agcaagcagacctaatttaca 264
              |||||||||||||||||||||
Sbjct: 117220 agcaagcagacctaatttaca 117240

>gb|AC161207.4| Mus musculus chromosome 1, clone RP23-66G23, complete sequence
          Length = 197037

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 65    atatgtttccagtttcctccc 85
             |||||||||||||||||||||
Sbjct: 30787 atatgtttccagtttcctccc 30807

>gb|AC068780.31| Homo sapiens 12 BAC RP11-163B7 (Roswell Park Cancer Institute Human
           BAC Library) complete sequence
          Length = 105836

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 156 tttggagtgcactgcattgta 176
           |||||||||||||||||||||
Sbjct: 101 tttggagtgcactgcattgta 121

>gb|AC138331.4| Homo sapiens 12 BAC RP11-781A6 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 113301

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 156  tttggagtgcactgcattgta 176
            |||||||||||||||||||||
Sbjct: 7616 tttggagtgcactgcattgta 7636

>gb|AC112941.7| Mus musculus chromosome 1, clone RP23-466C15, complete sequence
          Length = 166705

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 65     atatgtttccagtttcctccc 85
              |||||||||||||||||||||
Sbjct: 105303 atatgtttccagtttcctccc 105323

>emb|X74476.1|HPV34 Human papillomavirus type 34 genomic DNA
          Length = 7723

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 65   atatgtttccagtttcctcc 84
            ||||||||||||||||||||
Sbjct: 2169 atatgtttccagtttcctcc 2150

>gb|AC018788.10| Homo sapiens chromosome , clone RP11-24E9, complete sequence
          Length = 146883

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   ataacattacctggatctca 308
             ||||||||||||||||||||
Sbjct: 95912 ataacattacctggatctca 95893

>emb|BX004821.5| Zebrafish DNA sequence from clone CH211-171A11 in linkage group 19,
             complete sequence
          Length = 127311

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    cagtttcctccccatataca 93
             ||||||||||||||||||||
Sbjct: 27011 cagtttcctccccatataca 27030

>gb|AE003818.3| Drosophila melanogaster chromosome 2R, section 32 of 73 of the complete
             sequence
          Length = 291923

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    taaattacgggtatatgttt 72
             ||||||||||||||||||||
Sbjct: 83152 taaattacgggtatatgttt 83133

>gb|AC006422.1|AC006422 Drosophila melanogaster, chromosome 2R, region 50A2-50A3, P1 clones
              DS08976 and DS01149, complete sequence
          Length = 129605

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 53     taaattacgggtatatgttt 72
              ||||||||||||||||||||
Sbjct: 124008 taaattacgggtatatgttt 123989

>gb|AC091144.12| Homo sapiens chromosome 8, clone RP11-359B20, complete sequence
          Length = 185872

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 122   ccatgcccagcaattttgca 141
             ||||||||||||||||||||
Sbjct: 28021 ccatgcccagcaattttgca 28002


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,799,369
Number of Sequences: 3902068
Number of extensions: 2799369
Number of successful extensions: 50742
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50729
Number of HSP's gapped (non-prelim): 13
length of query: 308
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 286
effective length of database: 17,147,199,772
effective search space: 4904099134792
effective search space used: 4904099134792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)