ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl53b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_202718.1| Arabidopsis thaliana alpha-galactosidase/ hydro... 42 1.3
2ref|NM_115489.4| Arabidopsis thaliana alpha-galactosidase/ hydro... 42 1.3
3gb|AY114020.1| Arabidopsis thaliana putative alpha-galactosidase... 42 1.3
4gb|AY074321.1| Arabidopsis thaliana putative alpha-galactosidase... 42 1.3
5emb|AL163763.1|ATF18O21 Arabidopsis thaliana DNA chromosome 3, B... 42 1.3
6gb|AC098576.7| Drosophila melanogaster X BAC RP98-3E12 (Roswell ... 42 1.3
7emb|BX822543.1|CNS0A7LR Arabidopsis thaliana Full-length cDNA Co... 42 1.3
8emb|BX822739.1|CNS0A62G Arabidopsis thaliana Full-length cDNA Co... 42 1.3
9emb|BX825040.1|CNS0A5R8 Arabidopsis thaliana Full-length cDNA Co... 42 1.3
10emb|BX822949.1|CNS0A5TS Arabidopsis thaliana Full-length cDNA Co... 42 1.3
11emb|BX823822.1|CNS0A5CU Arabidopsis thaliana Full-length cDNA Co... 42 1.3
12emb|BX823782.1|CNS0A5D5 Arabidopsis thaliana Full-length cDNA Co... 42 1.3
13emb|BX823606.1|CNS0A5EQ Arabidopsis thaliana Full-length cDNA Co... 42 1.3
14emb|BX823461.1|CNS0A5D8 Arabidopsis thaliana Full-length cDNA Co... 42 1.3
15emb|BX823316.1|CNS0A5G0 Arabidopsis thaliana Full-length cDNA Co... 42 1.3
16emb|BX823260.1|CNS0A5BJ Arabidopsis thaliana Full-length cDNA Co... 42 1.3
17emb|BX823219.1|CNS0A5DO Arabidopsis thaliana Full-length cDNA Co... 42 1.3
18emb|BX826044.1|CNS0A543 Arabidopsis thaliana Full-length cDNA Co... 42 1.3
19gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 42 1.3
20emb|AL030994.1|DMC4F1 Drosophila melanogaster cosmid clone 4F1 42 1.3
21gb|AC102376.14| Mus musculus chromosome 18, clone RP23-314H11, c... 40 5.1
22ref|NM_204546.2| Gallus gallus RAD52 motif 1 (RDM1), mRNA 40 5.1
23gb|AC125141.4| Mus musculus BAC clone RP24-333C3 from chromosome... 40 5.1
24gb|AC125174.3| Mus musculus BAC clone RP24-544G11 from chromosom... 40 5.1
25emb|CR407555.9| Zebrafish DNA sequence from clone DKEY-260H8 in ... 40 5.1
26dbj|AB248100.1| Gallus gallus RDM1 gene for RAD52 motif 1, compl... 40 5.1
27gb|AC093419.2| Homo sapiens chromosome 1 clone RP11-135A15, comp... 40 5.1
28gb|AC093561.2| Homo sapiens chromosome 1 clone RP11-401A10, comp... 40 5.1
29emb|BX824901.1|CNS0A4O4 Arabidopsis thaliana Full-length cDNA Co... 40 5.1
30dbj|AB080727.1| Gallus gallus mRNA for RDM1, complete cds 40 5.1

>ref|NM_202718.1| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
           O-glycosyl compounds AT3G56310 transcript variant
           AT3G56310.2 mRNA, complete cds
          Length = 1879

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 534 caaaaatgtctgcatcatcca 514



to top

>ref|NM_115489.4| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
           O-glycosyl compounds AT3G56310 transcript variant
           AT3G56310.1 mRNA, complete cds
          Length = 1975

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 630 caaaaatgtctgcatcatcca 610



to top

>gb|AY114020.1| Arabidopsis thaliana putative alpha-galactosidase (At3g56310) mRNA,
           complete cds
          Length = 1345

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 547 caaaaatgtctgcatcatcca 527



to top

>gb|AY074321.1| Arabidopsis thaliana putative alpha-galactosidase (At3g56310) mRNA,
           complete cds
          Length = 1527

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 606 caaaaatgtctgcatcatcca 586



to top

>emb|AL163763.1|ATF18O21 Arabidopsis thaliana DNA chromosome 3, BAC clone F18O21
          Length = 99492

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 156   caaaaatgtctgcatcatcca 176
             |||||||||||||||||||||
Sbjct: 87064 caaaaatgtctgcatcatcca 87044



to top

>gb|AC098576.7| Drosophila melanogaster X BAC RP98-3E12 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 175262

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 167   gcatcatccagtgcatgttta 187
             |||||||||||||||||||||
Sbjct: 80134 gcatcatccagtgcatgttta 80114



to top

>emb|BX822543.1|CNS0A7LR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB47ZF09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1407

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 580 caaaaatgtctgcatcatcca 560



to top

>emb|BX822739.1|CNS0A62G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB60ZF05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1429

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 579 caaaaatgtctgcatcatcca 559



to top

>emb|BX825040.1|CNS0A5R8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH90ZH12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 583 caaaaatgtctgcatcatcca 563



to top

>emb|BX822949.1|CNS0A5TS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1350

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 510 caaaaatgtctgcatcatcca 490



to top

>emb|BX823822.1|CNS0A5CU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS7ZD12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1467

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 600 caaaaatgtctgcatcatcca 580



to top

>emb|BX823782.1|CNS0A5D5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS75ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1482

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 630 caaaaatgtctgcatcatcca 610



to top

>emb|BX823606.1|CNS0A5EQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZB03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1464

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 580 caaaaatgtctgcatcatcca 560



to top

>emb|BX823461.1|CNS0A5D8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS40ZG10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1456

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 594 caaaaatgtctgcatcatcca 574



to top

>emb|BX823316.1|CNS0A5G0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZH04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1487

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 626 caaaaatgtctgcatcatcca 606



to top

>emb|BX823260.1|CNS0A5BJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS18ZC02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1476

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 573 caaaaatgtctgcatcatcca 553



to top

>emb|BX823219.1|CNS0A5DO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS12ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1411

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 561 caaaaatgtctgcatcatcca 541



to top

>emb|BX826044.1|CNS0A543 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL81ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 156 caaaaatgtctgcatcatcca 176
           |||||||||||||||||||||
Sbjct: 596 caaaaatgtctgcatcatcca 576



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
              sequence
          Length = 304204

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 167    gcatcatccagtgcatgttta 187
              |||||||||||||||||||||
Sbjct: 287937 gcatcatccagtgcatgttta 287917



to top

>emb|AL030994.1|DMC4F1 Drosophila melanogaster cosmid clone 4F1
          Length = 44352

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 167   gcatcatccagtgcatgttta 187
             |||||||||||||||||||||
Sbjct: 20473 gcatcatccagtgcatgttta 20453



to top

>gb|AC102376.14| Mus musculus chromosome 18, clone RP23-314H11, complete sequence
          Length = 190153

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 304    tgcttgagtctgtcttgtag 323
              ||||||||||||||||||||
Sbjct: 132601 tgcttgagtctgtcttgtag 132620



to top

>ref|NM_204546.2| Gallus gallus RAD52 motif 1 (RDM1), mRNA
          Length = 1411

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 145  aaaattaggcccaaaaatgt 164
            ||||||||||||||||||||
Sbjct: 998  aaaattaggcccaaaaatgt 1017



to top

>gb|AC125141.4| Mus musculus BAC clone RP24-333C3 from chromosome 17, complete sequence
          Length = 148447

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   tctgtcttgtagccctttta 331
             ||||||||||||||||||||
Sbjct: 74368 tctgtcttgtagccctttta 74349



to top

>gb|AC125174.3| Mus musculus BAC clone RP24-544G11 from chromosome 16, complete sequence
          Length = 196646

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     aggactcagggtaaaatgaa 98
              ||||||||||||||||||||
Sbjct: 122288 aggactcagggtaaaatgaa 122307



to top

>emb|CR407555.9| Zebrafish DNA sequence from clone DKEY-260H8 in linkage group 5,
            complete sequence
          Length = 156095

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 171  catccagtgcatgtttacac 190
            ||||||||||||||||||||
Sbjct: 1074 catccagtgcatgtttacac 1093



to top

>dbj|AB248100.1| Gallus gallus RDM1 gene for RAD52 motif 1, complete cds
          Length = 5599

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 145  aaaattaggcccaaaaatgt 164
            ||||||||||||||||||||
Sbjct: 4408 aaaattaggcccaaaaatgt 4427



to top

>gb|AC093419.2| Homo sapiens chromosome 1 clone RP11-135A15, complete sequence
          Length = 163209

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   ttccatgtcagctcttctaa 213
             ||||||||||||||||||||
Sbjct: 38608 ttccatgtcagctcttctaa 38589



to top

>gb|AC093561.2| Homo sapiens chromosome 1 clone RP11-401A10, complete sequence
          Length = 184330

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 194  ttccatgtcagctcttctaa 213
            ||||||||||||||||||||
Sbjct: 1288 ttccatgtcagctcttctaa 1307



to top

>emb|BX824901.1|CNS0A4O4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH81ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1413

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 157 aaaaatgtctgcatcatcca 176
           ||||||||||||||||||||
Sbjct: 578 aaaaatgtctgcatcatcca 559



to top

>dbj|AB080727.1| Gallus gallus mRNA for RDM1, complete cds
          Length = 1433

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 145  aaaattaggcccaaaaatgt 164
            ||||||||||||||||||||
Sbjct: 998  aaaattaggcccaaaaatgt 1017


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,363,731
Number of Sequences: 3902068
Number of extensions: 3363731
Number of successful extensions: 58864
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58828
Number of HSP's gapped (non-prelim): 36
length of query: 382
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 360
effective length of database: 17,147,199,772
effective search space: 6172991917920
effective search space used: 6172991917920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top