ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl53a06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY111486.1| Zea mays CL9680_1 mRNA sequence 90 7e-15
2dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
3dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
4dbj|AK120291.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
5dbj|AK101189.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
6gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 82 2e-12
7gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 82 2e-12
8emb|BX072548.4|CNS09S4R Oryza sativa chromosome 11, . BAC OSJNBa... 82 2e-12
9emb|BX000503.2|CNS08CDT Oryza sativa chromosome 12, . BAC OSJNBb... 82 2e-12
10emb|BX000496.1|CNS08CDM Oryza sativa chromosome 12, . BAC OSJNBa... 82 2e-12
11gb|CP000088.1| Thermobifida fusca YX, complete genome 44 0.36
12emb|AL928693.9| Mouse DNA sequence from clone RP23-407K8 on chro... 44 0.36
13emb|AJ508939.1|PFR508939 Propionibacterium freudenreichii subsp.... 42 1.4
14gb|AC006920.11| Arabidopsis thaliana chromosome 2 clone F26H6 ma... 42 1.4
15ref|XM_481062.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.6
16gb|AF467766.1| Mus musculus guanine nucleotide exchange factor (... 40 5.6
17ref|NM_027144.1| Mus musculus Rho guanine nucleotide exchange fa... 40 5.6
18emb|Z37092.1|CEF44F4 Caenorhabditis elegans Cosmid F44F4, comple... 40 5.6
19gb|AC110169.7| Mus musculus chromosome 9, clone RP23-233D3, comp... 40 5.6
20emb|AL354775.12| Human DNA sequence from clone RP11-223F20 on ch... 40 5.6
21emb|BX070348.1|CNS09QG0 Single read from an extremity of a full-... 40 5.6
22emb|BX065472.1|CNS09MOK Single read from an extremity of a full-... 40 5.6
23emb|BX054124.1|CNS09DXC Single read from an extremity of a full-... 40 5.6
24emb|BX051881.1|CNS09C71 Single read from an extremity of a full-... 40 5.6
25emb|BX051880.1|CNS09C70 Single read from an extremity of a full-... 40 5.6
26emb|BX042900.1|CNS0959K Single read from an extremity of a full-... 40 5.6
27emb|BX036808.1|CNS090KC Single read from an extremity of a full-... 40 5.6
28emb|BX031581.1|CNS08WJ5 Single read from an extremity of a full-... 40 5.6
29emb|BX031580.1|CNS08WJ4 Single read from an extremity of a full-... 40 5.6
30emb|BX028564.1|CNS08U7C Single read from an extremity of a full-... 40 5.6
31emb|BX027683.1|CNS08TIV Single read from an extremity of a full-... 40 5.6
32emb|BX026463.1|CNS08SKZ Single read from an extremity of a full-... 40 5.6
33emb|BX026180.1|CNS08SD4 Single read from an extremity of a full-... 40 5.6
34emb|BX026179.1|CNS08SD3 Single read from an extremity of a full-... 40 5.6
35emb|BX018948.1|CNS08MS8 Single read from an extremity of a full-... 40 5.6
36emb|BX013967.1|CNS08IXV Single read from an extremity of a full-... 40 5.6
37emb|AL645855.25| Mouse DNA sequence from clone RP23-122N23 on ch... 40 5.6
38gb|DQ397559.1| Cenarchaeum symbiosum clone C21G07, complete sequ... 40 5.6
39gb|U40939.1| Caenorhabditis elegans cosmid F13D11, complete sequ... 40 5.6
40gb|AY037792.1| Caenorhabditis elegans SRA-12 (sra-12) precursor ... 40 5.6
41ref|NM_063945.3| Caenorhabditis elegans Serpentine Receptor, cla... 40 5.6
42ref|NM_076576.2| Caenorhabditis elegans F13D11.1 (F13D11.1) mRNA... 40 5.6
43dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
44gb|AC154515.2| Mus musculus BAC clone RP24-81I13 from chromosome... 40 5.6
45gb|AC090023.20| Homo sapiens 12 BAC RP11-221N13 (Roswell Park Ca... 40 5.6
46dbj|AP005157.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
47ref|XM_317673.2| Anopheles gambiae str. PEST ENSANGP00000023637 ... 40 5.6
48ref|XM_317672.2| Anopheles gambiae str. PEST ENSANGP00000018531 ... 40 5.6
49gb|AY935257.1| Rattus norvegicus leukemia-associated Rho guanine... 40 5.6
50dbj|AK122267.1| Mus musculus mRNA for mKIAA0382 protein 40 5.6
51gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malay... 40 5.6
52gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 5.6
53ref|NM_001013246.1| Rattus norvegicus Rho guanine nucleotide exc... 40 5.6
54emb|AL953879.7| Zebrafish DNA sequence from clone CH211-151G18, ... 40 5.6
55emb|AL844195.12| Mouse DNA sequence from clone RP23-144K11 on ch... 40 5.6 
>gb|AY111486.1| Zea mays CL9680_1 mRNA sequence
          Length = 809

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Plus

                                                                       
Query: 329 atggcgatggcgtcctggatctccttgagcacctcggagatggttggcctctgcgcaccc 388
           ||||| |||||||||||||||||||||||||| || |||||||  |||||||| || |||
Sbjct: 301 atggcaatggcgtcctggatctccttgagcacttccgagatgggaggcctctgggcgccc 360

                                        
Query: 389 tttggcttgacacacatgatgcccacctc 417
           || ||||| |||||||| ||| |||||||
Sbjct: 361 ttgggcttcacacacattatggccacctc 389
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Plus

                                                                          
Query: 313    ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
              |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 112171 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 112230

                                               
Query: 373    tggcctctgcgcaccctttggcttgacacacat 405
               |||||| || | ||||| ||||| || |||||
Sbjct: 112231 cggcctcagcacccccttgggcttcacgcacat 112263



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                    
Query: 183    tctacctgaggcccggccgcatgagcatttcatcaaacgacgcgttctgctcca 236
              |||||||||| || || ||||||||||  |||||||||||||| ||||||||||
Sbjct: 112038 tctacctgagacctgggcgcatgagcagctcatcaaacgacgcattctgctcca 112091
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11,
              complete sequence
          Length = 28386948

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Plus

                                                                          
Query: 313    ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
              |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 116560 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 116619

                                               
Query: 373    tggcctctgcgcaccctttggcttgacacacat 405
               |||||| || | ||||| ||||| || |||||
Sbjct: 116620 cggcctcagcacccccttgggcttcacgcacat 116652
to top
>dbj|AK120291.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050I12, full
            insert sequence
          Length = 1455

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                        
Query: 313  ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
            |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 1141 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 1082

                                             
Query: 373  tggcctctgcgcaccctttggcttgacacacat 405
             |||||| || | ||||| ||||| || |||||
Sbjct: 1081 cggcctcagcacccccttgggcttcacgcacat 1049



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 183  tctacctgaggcccggccgcatgagcatttcatcaaacgacgcgttctgctcca 236
            |||||||||| || || ||||||||||  |||||||||||||| ||||||||||
Sbjct: 1274 tctacctgagacctgggcgcatgagcagctcatcaaacgacgcattctgctcca 1221
to top
>dbj|AK101189.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030E21, full
            insert sequence
          Length = 3318

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                        
Query: 313  ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
            |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 2891 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 2832

                                             
Query: 373  tggcctctgcgcaccctttggcttgacacacat 405
             |||||| || | ||||| ||||| || |||||
Sbjct: 2831 cggcctcagcacccccttgggcttcacgcacat 2799



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 183  tctacctgaggcccggccgcatgagcatttcatcaaacgacgcgttctgctcca 236
            |||||||||| || || ||||||||||  |||||||||||||| ||||||||||
Sbjct: 3024 tctacctgagacctgggcgcatgagcagctcatcaaacgacgcattctgctcca 2971
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Plus

                                                                          
Query: 313    ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
              |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 116560 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 116619

                                               
Query: 373    tggcctctgcgcaccctttggcttgacacacat 405
               |||||| || | ||||| ||||| || |||||
Sbjct: 116620 cggcctcagcacccccttgggcttcacgcacat 116652
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Plus

                                                                          
Query: 313    ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
              |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 112171 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 112230

                                               
Query: 373    tggcctctgcgcaccctttggcttgacacacat 405
               |||||| || | ||||| ||||| || |||||
Sbjct: 112231 cggcctcagcacccccttgggcttcacgcacat 112263



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                    
Query: 183    tctacctgaggcccggccgcatgagcatttcatcaaacgacgcgttctgctcca 236
              |||||||||| || || ||||||||||  |||||||||||||| ||||||||||
Sbjct: 112038 tctacctgagacctgggcgcatgagcagctcatcaaacgacgcattctgctcca 112091
to top
>emb|BX072548.4|CNS09S4R Oryza sativa chromosome 11, . BAC OSJNBa0029D01 of library OSJNBa from
              chromosome 11 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 147503

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Plus

                                                                          
Query: 313    ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
              |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 116560 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 116619

                                               
Query: 373    tggcctctgcgcaccctttggcttgacacacat 405
               |||||| || | ||||| ||||| || |||||
Sbjct: 116620 cggcctcagcacccccttgggcttcacgcacat 116652
to top
>emb|BX000503.2|CNS08CDT Oryza sativa chromosome 12, . BAC OSJNBb0077A02 of library OSJNBb from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 131346

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Plus

                                                                          
Query: 313    ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
              |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 112171 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 112230

                                               
Query: 373    tggcctctgcgcaccctttggcttgacacacat 405
               |||||| || | ||||| ||||| || |||||
Sbjct: 112231 cggcctcagcacccccttgggcttcacgcacat 112263



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                    
Query: 183    tctacctgaggcccggccgcatgagcatttcatcaaacgacgcgttctgctcca 236
              |||||||||| || || ||||||||||  |||||||||||||| ||||||||||
Sbjct: 112038 tctacctgagacctgggcgcatgagcagctcatcaaacgacgcattctgctcca 112091
to top
>emb|BX000496.1|CNS08CDM Oryza sativa chromosome 12, . BAC OSJNBa0096E03 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 161808

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Plus

                                                                         
Query: 313   ctcccgctgcacctcgatggcgatggcgtcctggatctccttgagcacctcggagatggt 372
             |||||| |||| ||||||||| ||||||||||| ||||||||||||||||| ||||||| 
Sbjct: 63780 ctcccgttgcagctcgatggcaatggcgtcctgaatctccttgagcacctccgagatgga 63839

                                              
Query: 373   tggcctctgcgcaccctttggcttgacacacat 405
              |||||| || | ||||| ||||| || |||||
Sbjct: 63840 cggcctcagcacccccttgggcttcacgcacat 63872



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 183   tctacctgaggcccggccgcatgagcatttcatcaaacgacgcgttctgctcca 236
             |||||||||| || || ||||||||||  |||||||||||||| ||||||||||
Sbjct: 63647 tctacctgagacctgggcgcatgagcagctcatcaaacgacgcattctgctcca 63700
to top
>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 339     cgtcctggatctccttgagcac 360
               ||||||||||||||||||||||
Sbjct: 3524714 cgtcctggatctccttgagcac 3524693
to top
>emb|AL928693.9| Mouse DNA sequence from clone RP23-407K8 on chromosome 2, complete
              sequence
          Length = 206478

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 121    actaacacatgagcatctcctt 142
              ||||||||||||||||||||||
Sbjct: 102198 actaacacatgagcatctcctt 102219
to top
>emb|AJ508939.1|PFR508939 Propionibacterium freudenreichii subsp. shermanii fba1 gene for
           fructose-bisphosphate aldolase class II
          Length = 1023

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 337 ggcgtcctggatctccttgag 357
           |||||||||||||||||||||
Sbjct: 699 ggcgtcctggatctccttgag 679
to top
>gb|AC006920.11| Arabidopsis thaliana chromosome 2 clone F26H6 map mi398, complete
             sequence
          Length = 89301

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 11    acaacagttccagatcaccattctt 35
             ||||||||||||| |||||||||||
Sbjct: 55538 acaacagttccagctcaccattctt 55562
to top
>ref|XM_481062.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 699

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 337 ggcgtcctggatctccttga 356
           ||||||||||||||||||||
Sbjct: 510 ggcgtcctggatctccttga 491
to top
>gb|AF467766.1| Mus musculus guanine nucleotide exchange factor (Larg) mRNA, complete
            cds
          Length = 10040

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 336  tggcgtcctggatctccttgagca 359
            |||| |||||||||||||||||||
Sbjct: 1000 tggcctcctggatctccttgagca 977
to top
>ref|NM_027144.1| Mus musculus Rho guanine nucleotide exchange factor (GEF) 12
            (Arhgef12), mRNA
          Length = 10040

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 336  tggcgtcctggatctccttgagca 359
            |||| |||||||||||||||||||
Sbjct: 1000 tggcctcctggatctccttgagca 977
to top
>emb|Z37092.1|CEF44F4 Caenorhabditis elegans Cosmid F44F4, complete sequence
          Length = 40094

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     agaaaacaacagttccagat 25
             ||||||||||||||||||||
Sbjct: 25058 agaaaacaacagttccagat 25039
to top
>gb|AC110169.7| Mus musculus chromosome 9, clone RP23-233D3, complete sequence
          Length = 193041

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 336    tggcgtcctggatctccttgagca 359
              |||| |||||||||||||||||||
Sbjct: 149272 tggcctcctggatctccttgagca 149249
to top
>emb|AL354775.12| Human DNA sequence from clone RP11-223F20 on chromosome 13 Contains a
              novel heterogeneous nuclear ribonucleoprotein family A
              protein and a novel gene, complete sequence
          Length = 168897

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 339    cgtcctggatctccttgagc 358
              ||||||||||||||||||||
Sbjct: 148548 cgtcctggatctccttgagc 148567
to top
>emb|BX070348.1|CNS09QG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 571 tggcgatggcgtcctggatc 552
to top
>emb|BX065472.1|CNS09MOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 771 tggcgatggcgtcctggatc 752
to top
>emb|BX054124.1|CNS09DXC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 823 tggcgatggcgtcctggatc 804
to top
>emb|BX051881.1|CNS09C71 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 665 tggcgatggcgtcctggatc 684
to top
>emb|BX051880.1|CNS09C70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 765 tggcgatggcgtcctggatc 746
to top
>emb|BX042900.1|CNS0959K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 682 tggcgatggcgtcctggatc 663
to top
>emb|BX036808.1|CNS090KC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 780 tggcgatggcgtcctggatc 761
to top
>emb|BX031581.1|CNS08WJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 753 tggcgatggcgtcctggatc 772
to top
>emb|BX031580.1|CNS08WJ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1065

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 794 tggcgatggcgtcctggatc 775
to top
>emb|BX028564.1|CNS08U7C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 778 tggcgatggcgtcctggatc 759
to top
>emb|BX027683.1|CNS08TIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1070

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 830 tggcgatggcgtcctggatc 811
to top
>emb|BX026463.1|CNS08SKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 772 tggcgatggcgtcctggatc 753
to top
>emb|BX026180.1|CNS08SD4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 663 tggcgatggcgtcctggatc 682
to top
>emb|BX026179.1|CNS08SD3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 776 tggcgatggcgtcctggatc 757
to top
>emb|BX018948.1|CNS08MS8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 380 tggcgatggcgtcctggatc 361
to top
>emb|BX013967.1|CNS08IXV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 521 tggcgatggcgtcctggatc 502
to top
>emb|AL645855.25| Mouse DNA sequence from clone RP23-122N23 on chromosome 11 Contains a
             novel gene, complete sequence
          Length = 203914

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    gatcaccattctttcaccat 42
             ||||||||||||||||||||
Sbjct: 90521 gatcaccattctttcaccat 90502
to top
>gb|DQ397559.1| Cenarchaeum symbiosum clone C21G07, complete sequence
          Length = 38150

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 339   cgtcctggatctccttgagcacct 362
             ||||||||||||||||||| ||||
Sbjct: 25494 cgtcctggatctccttgaggacct 25517
to top
>gb|U40939.1| Caenorhabditis elegans cosmid F13D11, complete sequence
          Length = 32719

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 90    ttcaaatcatcaccaggaaa 109
             ||||||||||||||||||||
Sbjct: 25309 ttcaaatcatcaccaggaaa 25290
to top
>gb|AY037792.1| Caenorhabditis elegans SRA-12 (sra-12) precursor RNA, sra-12(+)
           allele, complete cds; and GLY-1 (gly-1) precursor RNA,
           gly-1(+) allele, complete cds
          Length = 2656

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 6   agaaaacaacagttccagat 25
           ||||||||||||||||||||
Sbjct: 214 agaaaacaacagttccagat 233
to top
>ref|NM_063945.3| Caenorhabditis elegans Serpentine Receptor, class A (alpha) family
           member (sra-12) (sra-12) mRNA, complete cds
          Length = 1031

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 6   agaaaacaacagttccagat 25
           ||||||||||||||||||||
Sbjct: 178 agaaaacaacagttccagat 197
to top
>ref|NM_076576.2| Caenorhabditis elegans F13D11.1 (F13D11.1) mRNA, complete cds
          Length = 1357

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ttcaaatcatcaccaggaaa 109
           ||||||||||||||||||||
Sbjct: 131 ttcaaatcatcaccaggaaa 112
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 337     ggcgtcctggatctccttga 356
               ||||||||||||||||||||
Sbjct: 9553591 ggcgtcctggatctccttga 9553610
to top
>gb|AC154515.2| Mus musculus BAC clone RP24-81I13 from chromosome 14, complete sequence
          Length = 172475

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 109   acagaaagactaactaacacatga 132
             |||||||||| |||||||||||||
Sbjct: 22548 acagaaagaccaactaacacatga 22525
to top
>gb|AC090023.20| Homo sapiens 12 BAC RP11-221N13 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 114177

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 129    atgagcatctccttctcctt 148
              ||||||||||||||||||||
Sbjct: 105944 atgagcatctccttctcctt 105925
to top
>dbj|AP005157.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0005L24
          Length = 155365

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 337   ggcgtcctggatctccttga 356
             ||||||||||||||||||||
Sbjct: 83621 ggcgtcctggatctccttga 83640
to top
>ref|XM_317673.2| Anopheles gambiae str. PEST ENSANGP00000023637
           (ENSANGG00000016042), partial mRNA
          Length = 804

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 802 tggcgatggcgtcctggatc 783
to top
>ref|XM_317672.2| Anopheles gambiae str. PEST ENSANGP00000018531
           (ENSANGG00000016042), mRNA
          Length = 1886

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 tggcgatggcgtcctggatc 349
           ||||||||||||||||||||
Sbjct: 825 tggcgatggcgtcctggatc 806
to top
>gb|AY935257.1| Rattus norvegicus leukemia-associated Rho guanine nucleotide
           exchange factor (Larg) mRNA, complete cds
          Length = 4668

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 336 tggcgtcctggatctccttgagca 359
           |||| |||||||||||||||||||
Sbjct: 727 tggcctcctggatctccttgagca 704
to top
>dbj|AK122267.1| Mus musculus mRNA for mKIAA0382 protein
          Length = 6003

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 336  tggcgtcctggatctccttgagca 359
            |||| |||||||||||||||||||
Sbjct: 1235 tggcctcctggatctccttgagca 1212
to top
>gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malayi, complete genome
          Length = 1080084

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ctttcaaatcatcaccagga 107
              ||||||||||||||||||||
Sbjct: 300742 ctttcaaatcatcaccagga 300723
to top
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 343     ctggatctccttgagcacct 362
               ||||||||||||||||||||
Sbjct: 1438890 ctggatctccttgagcacct 1438871
to top
>ref|NM_001013246.1| Rattus norvegicus Rho guanine nucleotide exchange factor (GEF) 12
           (Arhgef12), mRNA
          Length = 4668

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 336 tggcgtcctggatctccttgagca 359
           |||| |||||||||||||||||||
Sbjct: 727 tggcctcctggatctccttgagca 704
to top
>emb|AL953879.7| Zebrafish DNA sequence from clone CH211-151G18, complete sequence
          Length = 142739

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 8      aaaacaacagttccagatca 27
              ||||||||||||||||||||
Sbjct: 114355 aaaacaacagttccagatca 114374
to top
>emb|AL844195.12| Mouse DNA sequence from clone RP23-144K11 on chromosome X, complete
              sequence
          Length = 180916

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 109    acagaaagactaactaacac 128
              ||||||||||||||||||||
Sbjct: 172265 acagaaagactaactaacac 172284


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,716,862
Number of Sequences: 3902068
Number of extensions: 3716862
Number of successful extensions: 74613
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74342
Number of HSP's gapped (non-prelim): 271
length of query: 417
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 395
effective length of database: 17,147,199,772
effective search space: 6773143909940
effective search space used: 6773143909940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top