ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl50g12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BC112882.1| Bos taurus cDNA clone MGC:137458 IMAGE:8177370, c... 44 0.16
2gb|AY514766.1| Canis familiaris concentrative NA+-nucleoside cot... 42 0.62
3gb|AY563923.1| Agalinis linifolia isolate ali2 maturase K (matK)... 42 0.62
4gb|AY563922.1| Brachystigma wrightii isolate brwr1 maturase K (m... 42 0.62
5gb|AY563921.1| Dasistoma macrophylla isolate dama1 maturase K (m... 42 0.62
6gb|AY563920.1| Aureolaria pedicularia isolate auped3 maturase K ... 42 0.62
7gb|AY563919.1| Agalinis fasciculata isolate afa2 maturase K (mat... 42 0.62
8gb|AY563918.1| Agalinis heterophylla isolate txsp3_1 maturase K ... 42 0.62
9gb|AY563917.1| Agalinis auriculata isolate aau7 maturase K (matK... 42 0.62
10gb|AY563916.1| Agalinis tenuifolia isolate atu5 maturase K (matK... 42 0.62
11gb|AY563915.1| Agalinis plukenetii isolate apl2 maturase K (matK... 42 0.62
12gb|AY563914.1| Agalinis setacea isolate ase3 maturase K (matK) g... 42 0.62
13gb|AY563913.1| Agalinis strictifolia isolate ast4 maturase K (ma... 42 0.62
14gb|AY563912.1| Agalinis pulchella isolate apul3 maturase K (matK... 42 0.62
15gb|AY563910.1| Agalinis obtusifolia isolate aob20 maturase K (ma... 42 0.62
16gb|AY563909.1| Agalinis tenella isolate ate4 maturase K (matK) g... 42 0.62
17gb|AY563908.1| Agalinis acuta isolate aac1 maturase K (matK) gen... 42 0.62
18gb|AY563907.1| Agalinis filicaulis isolate afi2 maturase K (matK... 42 0.62
19gb|AY563906.1| Agalinis divaricata isolate adi5 maturase K (matK... 42 0.62
20gb|AC107204.4| Homo sapiens 3p BAC RP11-655A17 (Roswell Park Can... 42 0.62
21gb|AY436323.1| Homo sapiens angiotensinogen (serine (or cysteine... 42 0.62
22gb|AC108709.3| Homo sapiens 3 BAC RP11-81P15 (Roswell Park Cance... 42 0.62
23emb|CR384100.8| Zebrafish DNA sequence from clone DKEYP-22H2 in ... 42 0.62
24gb|AF051999.1| Seymeria pectinata trnK gene, partial sequence; a... 42 0.62
25gb|AF051997.1| Paulownia tomentosa trnK gene, partial sequence; ... 42 0.62
26gb|AF051990.1| Lindenbergia phillipinensis trnK gene, partial se... 42 0.62
27gb|AF051981.1| Castilleja liniariifolia trnK gene, partial seque... 42 0.62
28gb|AF051979.1| Boschniakia hookeri trnK gene, partial sequence; ... 42 0.62
29emb|BX005330.13| Zebrafish DNA sequence from clone CH211-113D13,... 42 0.62
30gb|AC133208.3| Mus musculus BAC clone RP23-17O6 from chromosome ... 42 0.62
31emb|BX546504.9| Mouse DNA sequence from clone RP23-78N22 on chro... 42 0.62
32emb|AJ429350.1|SER429350 Stilbe ericoides chloroplast partial ma... 42 0.62
33emb|AJ429339.1|PTO429339 Paulownia tomentosa chloroplast partial... 42 0.62
34emb|AJ429337.1|LSP429337 Lindenbergia sp. Thulin 8079 chloroplas... 42 0.62
35emb|AL732571.8| Mouse DNA sequence from clone RP23-23D11 on chro... 42 0.62
36gb|AC169122.1| Mus musculus BAC clone RP23-167K9 from chromosome... 40 2.5
37gb|AY563911.1| Agalinis aphylla isolate aap3 maturase K (matK) g... 40 2.5
38gb|AC147083.2| Mus musculus BAC clone RP23-349M16 from chromosom... 40 2.5
39gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complet... 40 2.5
40gb|AF261829.1| Aspergillus flavus strain A399 acetamidase (amdS)... 40 2.5
41emb|AL162421.17| Human DNA sequence from clone RP11-415N7 on chr... 40 2.5
42emb|BX255918.16| Zebrafish DNA sequence from clone CH211-239I2 i... 40 2.5
43emb|BX323062.10| Zebrafish DNA sequence from clone DKEYP-38H2 in... 40 2.5
44gb|AF052000.1| Striga asiatica trnK gene, partial sequence; and ... 40 2.5
45gb|AF051977.1| Alectra sessiliflora trnK gene, partial sequence;... 40 2.5
46gb|AC069025.5| Homo sapiens chromosome 10 clone RP11-526G5, comp... 40 2.5
47emb|BX571844.5| Zebrafish DNA sequence from clone DKEY-264L19 in... 40 2.5
48emb|BX470199.6| Zebrafish DNA sequence from clone CH211-226M7 in... 40 2.5
49emb|BX649610.5| Zebrafish DNA sequence from clone CH211-170D11 i... 40 2.5
50emb|BX537162.5| Zebrafish DNA sequence from clone DKEY-9A20 in l... 40 2.5
51gb|AC104894.14| Mus musculus chromosome 1, clone RP23-290I22, co... 40 2.5
52gb|AY849604.1| Melasma scabrum maturase K (matK) gene, complete ... 40 2.5
53gb|AY849601.1| Cycnium racemosum maturase K (matK) gene, complet... 40 2.5
54gb|AF489963.1| Striga gesnerioides maturase K (matK) gene, parti... 40 2.5
55gb|AF489962.1| Buchnera hispida maturase K (matK) gene, partial ... 40 2.5
56gb|AF489960.1| Alectra orobanchoides maturase K (matK) gene, par... 40 2.5
57gb|AC134897.4| Mus musculus BAC clone RP23-459D9 from 6, complet... 40 2.5
58gb|AC173339.1| Mus musculus BAC clone RP24-221C22 from chromosom... 40 2.5
59gb|AC153632.2| Mus musculus 6 BAC RP23-450O1 (Roswell Park Cance... 40 2.5
60gb|AC157811.3| Mus musculus chromosome 1, clone RP24-377C24, com... 40 2.5
61gb|AC169676.2| Mus musculus BAC clone RP24-163P20 from chromosom... 40 2.5
62emb|AJ429336.1|CSO429336 Cyclocheilon somaliense chloroplast mat... 40 2.5
63gb|CP000110.1| Synechococcus sp. CC9605, complete genome 38 9.7
64gb|AC153356.5| Mus musculus BAC clone RP24-477I13 from chromosom... 38 9.7
65ref|XM_516003.1| PREDICTED: Pan troglodytes similar to hypotheti... 38 9.7
66gb|AC117734.13| Mus musculus chromosome 1, clone RP24-130L9, com... 38 9.7
67gb|AC120877.15| Mus musculus chromosome 6, clone RP24-548D19, co... 38 9.7
68gb|AC012650.9| Drosophila melanogaster clone BACN24N09, complete... 38 9.7
69gb|AC095825.6| Rattus norvegicus 4 BAC CH230-9J6 (Children's Hos... 38 9.7
70gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, c... 38 9.7
71gb|AC129189.3| Mus musculus BAC clone RP24-67O22 from chromosome... 38 9.7
72gb|AC118212.7| Mus musculus chromosome 6, clone RP24-170E4, comp... 38 9.7
73emb|AL929389.9| Zebrafish DNA sequence from clone CH211-51H4 in ... 38 9.7
74gb|AC122825.4| Mus musculus BAC clone RP23-209E13 from 10, compl... 38 9.7
75gb|AC004009.1| Homo sapiens PAC clone RP5-1103I5 from 7, complet... 38 9.7
76gb|AC102663.6| Mus musculus chromosome 6, clone RP23-244M15, com... 38 9.7
77gb|AC159973.2| Mus musculus chromosome 1, clone RP24-207D15, com... 38 9.7
78emb|AL356240.15| Human DNA sequence from clone RP5-873F21 on chr... 38 9.7
79emb|AL353751.13| Human DNA sequence from clone RP11-149I23 on ch... 38 9.7
80emb|AL672216.10| Zebrafish DNA sequence from clone BUSM1-44O19 i... 38 9.7
81emb|CR927553.8| Zebrafish DNA sequence from clone DKEY-206P8 in ... 38 9.7
82emb|BX571703.10| Zebrafish DNA sequence from clone DKEY-188E21 i... 38 9.7
83gb|AC101771.11| Mus musculus chromosome 15, clone RP24-104H19, c... 38 9.7
84gb|AC096539.2| Homo sapiens chromosome 1 clone RP11-150L22, comp... 38 9.7
85emb|BX005412.17| Zebrafish DNA sequence from clone DKEY-23O4 in ... 38 9.7
86gb|AC021630.11| Mus musculus chromosome 14, clone RP23-178B24, c... 38 9.7
87emb|BX664749.12| Zebrafish DNA sequence from clone DKEY-53M7 in ... 38 9.7
88gb|AC113266.24| Papio anubis clone rp41-106a4, complete sequence 38 9.7
89ref|NM_141175.2| Drosophila melanogaster Mes2 CG11100-RA, transc... 38 9.7
90gb|AY060486.1| Drosophila melanogaster SD10763 full length cDNA 38 9.7
91emb|BX664616.16| Zebrafish DNA sequence from clone DKEY-231P15 i... 38 9.7
92gb|AC160942.1| Pan troglodytes BAC clone CH251-443J9 from chromo... 38 9.7
93gb|AC010607.8| Homo sapiens chromosome 5 clone CTB-28D11, comple... 38 9.7
94gb|AC011758.6|AC011758 Drosophila melanogaster, chromosome X, re... 38 9.7
95emb|BX537276.5| Zebrafish DNA sequence from clone DKEYP-57A10 in... 38 9.7
96gb|AC007476.5|AC007476 Drosophila melanogaster, chromosome 2R, r... 38 9.7
97gb|AC009503.3| Homo sapiens BAC clone RP11-516K23 from 2, comple... 38 9.7
98gb|AC157527.2| Pan troglodytes BAC clone CH251-513D12 from chrom... 38 9.7
99gb|AC146167.2| Pan troglodytes BAC clone RP43-1E11 from chromoso... 38 9.7
100gb|AC017035.6| Homo sapiens BAC clone RP11-310J20 from 2, comple... 38 9.7
101gb|AF250284.1|AF250284 Amsacta moorei entomopoxvirus, complete g... 38 9.7
102emb|BX510916.7| Zebrafish DNA sequence from clone DKEY-208B17 in... 38 9.7
103emb|AL954866.11| Zebrafish DNA sequence from clone CH211-10D23 i... 38 9.7
104emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in... 38 9.7
105emb|AL807785.7| Mouse DNA sequence from clone RP23-460B18 on chr... 38 9.7
106gb|AC154837.2| Mus musculus BAC clone RP24-576O2 from 14, comple... 38 9.7
107gb|AC005720.6|AC005720 Drosophila melanogaster, chromosome 3L, r... 38 9.7
108gb|AE003822.3| Drosophila melanogaster chromosome 2R, section 28... 38 9.7
109gb|AE003599.2| Drosophila melanogaster chromosome 3L, section 80... 38 9.7
110gb|AE003571.4| Drosophila melanogaster chromosome X, section 68 ... 38 9.7
111dbj|AP003969.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 38 9.7
112emb|BX248414.5| Zebrafish DNA sequence from clone CH211-236E8, c... 38 9.7
113emb|CR847947.14| Zebrafish DNA sequence from clone DKEY-56M16 in... 38 9.7
114emb|CR759821.9| Zebrafish DNA sequence from clone DKEY-190C14 in... 38 9.7
115gb|AC170807.2| Mus musculus BAC clone RP23-374I2 from chromosome... 38 9.7
116gb|AC170884.3| Mus musculus BAC clone RP24-111L17 from chromosom... 38 9.7
117emb|AJ429326.1|ALO429326 Acanthus longifolius chloroplast partia... 38 9.7
118emb|AL627128.16| Mouse DNA sequence from clone RP23-133J9 on chr... 38 9.7
119emb|AL139099.3|CNS01DX7 Human chromosome 14 DNA sequence BAC R-6... 38 9.7
120dbj|AB036638.1| Lycium elongatum chloroplast matK gene for matur... 38 9.7 
>gb|BC112882.1| Bos taurus cDNA clone MGC:137458 IMAGE:8177370, complete cds
          Length = 1583

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 3    cacttaaaagaccaaatttcga 24
            ||||||||||||||||||||||
Sbjct: 1548 cacttaaaagaccaaatttcga 1569
to top
>gb|AY514766.1| Canis familiaris concentrative NA+-nucleoside cotransporter
           (SLC28A3) gene, exons 16, 17 and partial cds
          Length = 946

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 tgtaacattatttgtgtcagg 138
           |||||||||||||||||||||
Sbjct: 74  tgtaacattatttgtgtcagg 94
to top
>gb|AY563923.1| Agalinis linifolia isolate ali2 maturase K (matK) gene, complete
           cds; chloroplast
          Length = 2715

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 859 tcataacctggattttccgacaaaa 835
to top
>gb|AY563922.1| Brachystigma wrightii isolate brwr1 maturase K (matK) gene,
           complete cds; chloroplast
          Length = 2730

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 878 tcataacctggattttccgacaaaa 854
to top
>gb|AY563921.1| Dasistoma macrophylla isolate dama1 maturase K (matK) gene,
           complete cds; chloroplast
          Length = 2734

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 883 tcataacctggattttccgacaaaa 859
to top
>gb|AY563920.1| Aureolaria pedicularia isolate auped3 maturase K (matK) gene,
           complete cds; chloroplast
          Length = 2732

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 886 tcataacctggattttccgacaaaa 862
to top
>gb|AY563919.1| Agalinis fasciculata isolate afa2 maturase K (matK) gene, complete
           cds; chloroplast
          Length = 2725

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 878 tcataacctggattttccgacaaaa 854
to top
>gb|AY563918.1| Agalinis heterophylla isolate txsp3_1 maturase K (matK) gene,
            complete cds; chloroplast
          Length = 3733

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 44   tcatcacctggattttccgacaaaa 68
            |||| ||||||||||||||||||||
Sbjct: 1889 tcataacctggattttccgacaaaa 1865
to top
>gb|AY563917.1| Agalinis auriculata isolate aau7 maturase K (matK) gene, complete
           cds; chloroplast
          Length = 2720

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 877 tcataacctggattttccgacaaaa 853
to top
>gb|AY563916.1| Agalinis tenuifolia isolate atu5 maturase K (matK) gene, complete
           cds; chloroplast
          Length = 2725

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 877 tcataacctggattttccgacaaaa 853
to top
>gb|AY563915.1| Agalinis plukenetii isolate apl2 maturase K (matK) gene, complete
           cds; chloroplast
          Length = 2729

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 875 tcataacctggattttccgacaaaa 851
to top
>gb|AY563914.1| Agalinis setacea isolate ase3 maturase K (matK) gene, complete cds;
           chloroplast
          Length = 2737

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 876 tcataacctggattttccgacaaaa 852
to top
>gb|AY563913.1| Agalinis strictifolia isolate ast4 maturase K (matK) gene, complete
           cds; chloroplast
          Length = 2725

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 877 tcataacctggattttccgacaaaa 853
to top
>gb|AY563912.1| Agalinis pulchella isolate apul3 maturase K (matK) gene, complete
           cds; chloroplast
          Length = 2729

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 881 tcataacctggattttccgacaaaa 857
to top
>gb|AY563910.1| Agalinis obtusifolia isolate aob20 maturase K (matK) gene, complete
            cds; chloroplast
          Length = 3740

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 44   tcatcacctggattttccgacaaaa 68
            |||| ||||||||||||||||||||
Sbjct: 1893 tcataacctggattttccgacaaaa 1869
to top
>gb|AY563909.1| Agalinis tenella isolate ate4 maturase K (matK) gene, complete cds;
           chloroplast
          Length = 2727

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 880 tcataacctggattttccgacaaaa 856
to top
>gb|AY563908.1| Agalinis acuta isolate aac1 maturase K (matK) gene, complete cds;
            chloroplast
          Length = 3737

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 44   tcatcacctggattttccgacaaaa 68
            |||| ||||||||||||||||||||
Sbjct: 1890 tcataacctggattttccgacaaaa 1866
to top
>gb|AY563907.1| Agalinis filicaulis isolate afi2 maturase K (matK) gene, complete
           cds; chloroplast
          Length = 2748

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 868 tcataacctggattttccgacaaaa 844
to top
>gb|AY563906.1| Agalinis divaricata isolate adi5 maturase K (matK) gene, complete
            cds; chloroplast
          Length = 3736

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 44   tcatcacctggattttccgacaaaa 68
            |||| ||||||||||||||||||||
Sbjct: 1893 tcataacctggattttccgacaaaa 1869
to top
>gb|AC107204.4| Homo sapiens 3p BAC RP11-655A17 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 170799

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 153    atgaatgaatgaaacaaatgg 173
              |||||||||||||||||||||
Sbjct: 112569 atgaatgaatgaaacaaatgg 112589
to top
>gb|AY436323.1| Homo sapiens angiotensinogen (serine (or cysteine) proteinase
            inhibitor, clade A (alpha-1 antiproteinase, antitrypsin),
            member 8) (AGT) gene, complete cds
          Length = 15593

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 154  tgaatgaatgaaacaaatggtgagg 178
            |||||||||||||||||| ||||||
Sbjct: 1119 tgaatgaatgaaacaaattgtgagg 1143
to top
>gb|AC108709.3| Homo sapiens 3 BAC RP11-81P15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 179223

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 153    atgaatgaatgaaacaaatgg 173
              |||||||||||||||||||||
Sbjct: 167733 atgaatgaatgaaacaaatgg 167753
to top
>emb|CR384100.8| Zebrafish DNA sequence from clone DKEYP-22H2 in linkage group 13,
             complete sequence
          Length = 172918

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 153   atgaatgaatgaaacaaatgg 173
             |||||||||||||||||||||
Sbjct: 38831 atgaatgaatgaaacaaatgg 38851
to top
>gb|AF051999.1| Seymeria pectinata trnK gene, partial sequence; and maturase K
           (matK) gene, complete cds, chloroplast genes for
           chloroplast products
          Length = 2433

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 841 tcataacctggattttccgacaaaa 817
to top
>gb|AF051997.1| Paulownia tomentosa trnK gene, partial sequence; and maturase K
           (matK) gene, complete cds, chloroplast genes for
           chloroplast products
          Length = 2477

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 839 tcataacctggattttccgacaaaa 815
to top
>gb|AF051990.1| Lindenbergia phillipinensis trnK gene, partial sequence; and
           maturase K (matK) gene, complete cds, chloroplast genes
           for chloroplast products
          Length = 2417

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 833 tcataacctggattttccgacaaaa 809
to top
>gb|AF051981.1| Castilleja liniariifolia trnK gene, partial sequence; and maturase
           K (matK) gene, complete cds, chloroplast genes for
           chloroplast products
          Length = 2420

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 835 tcataacctggattttccgacaaaa 811
to top
>gb|AF051979.1| Boschniakia hookeri trnK gene, partial sequence; and maturase K
           (matK) gene, complete cds, chloroplast genes for
           chloroplast products
          Length = 2457

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 859 tcataacctggattttccgacaaaa 835
to top
>emb|BX005330.13| Zebrafish DNA sequence from clone CH211-113D13, complete sequence
          Length = 181197

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 153   atgaatgaatgaaacaaatgg 173
             |||||||||||||||||||||
Sbjct: 84686 atgaatgaatgaaacaaatgg 84706
to top
>gb|AC133208.3| Mus musculus BAC clone RP23-17O6 from chromosome unknown, complete
              sequence
          Length = 239189

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 113    atatatgtaacattatttgtg 133
              |||||||||||||||||||||
Sbjct: 120657 atatatgtaacattatttgtg 120637
to top
>emb|BX546504.9| Mouse DNA sequence from clone RP23-78N22 on chromosome X, complete
             sequence
          Length = 107447

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 113   atatatgtaacattatttgtg 133
             |||||||||||||||||||||
Sbjct: 71794 atatatgtaacattatttgtg 71774
to top
>emb|AJ429350.1|SER429350 Stilbe ericoides chloroplast partial matK gene for maturase
          Length = 1674

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                   
Query: 44 tcatcacctggattttccgacaaaa 68
          |||| ||||||||||||||||||||
Sbjct: 67 tcataacctggattttccgacaaaa 43
to top
>emb|AJ429339.1|PTO429339 Paulownia tomentosa chloroplast partial matK gene for maturase
          Length = 1771

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 146 tcataacctggattttccgacaaaa 122
to top
>emb|AJ429337.1|LSP429337 Lindenbergia sp. Thulin 8079 chloroplast partial matK gene for
           maturase
          Length = 1722

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 44  tcatcacctggattttccgacaaaa 68
           |||| ||||||||||||||||||||
Sbjct: 146 tcataacctggattttccgacaaaa 122
to top
>emb|AL732571.8| Mouse DNA sequence from clone RP23-23D11 on chromosome 4, complete
              sequence
          Length = 214061

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 134    tcaggaaaccatacacagcat 154
              |||||||||||||||||||||
Sbjct: 101613 tcaggaaaccatacacagcat 101593
to top
>gb|AC169122.1| Mus musculus BAC clone RP23-167K9 from chromosome 17, complete sequence
          Length = 127115

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   atgaatgaatgaaacaaatg 172
             ||||||||||||||||||||
Sbjct: 54553 atgaatgaatgaaacaaatg 54572
to top
>gb|AY563911.1| Agalinis aphylla isolate aap3 maturase K (matK) gene, complete cds;
           chloroplast
          Length = 2727

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 44  tcatcacctggattttccgacaaa 67
           |||| |||||||||||||||||||
Sbjct: 878 tcataacctggattttccgacaaa 855
to top
>gb|AC147083.2| Mus musculus BAC clone RP23-349M16 from chromosome 18, complete sequence
          Length = 211199

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    gcatgaatgaatgaaacaaa 170
              ||||||||||||||||||||
Sbjct: 157937 gcatgaatgaatgaaacaaa 157918
to top
>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence
          Length = 121598

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   atgaatgaatgaaacaaatg 172
             ||||||||||||||||||||
Sbjct: 62090 atgaatgaatgaaacaaatg 62109
to top
>gb|AF261829.1| Aspergillus flavus strain A399 acetamidase (amdS) gene, partial cds
          Length = 433

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 133 gtcaggaaaccatacacagc 152
           ||||||||||||||||||||
Sbjct: 110 gtcaggaaaccatacacagc 129
to top
>emb|AL162421.17| Human DNA sequence from clone RP11-415N7 on chromosome 9, complete
             sequence
          Length = 108032

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   atgaatgaatgaaacaaatg 172
             ||||||||||||||||||||
Sbjct: 46094 atgaatgaatgaaacaaatg 46113
to top
>emb|BX255918.16| Zebrafish DNA sequence from clone CH211-239I2 in linkage group 11,
              complete sequence
          Length = 189958

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 153    atgaatgaatgaaacaaatg 172
              ||||||||||||||||||||
Sbjct: 113999 atgaatgaatgaaacaaatg 114018
to top
>emb|BX323062.10| Zebrafish DNA sequence from clone DKEYP-38H2 in linkage group 5,
             complete sequence
          Length = 199133

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   atatgtaacattatttgtgt 134
             ||||||||||||||||||||
Sbjct: 29585 atatgtaacattatttgtgt 29604
to top
>gb|AF052000.1| Striga asiatica trnK gene, partial sequence; and maturase K (matK)
           gene, complete cds, chloroplast genes for chloroplast
           products
          Length = 2429

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  acctggattttccgacaaaa 68
           ||||||||||||||||||||
Sbjct: 825 acctggattttccgacaaaa 806
to top
>gb|AF051977.1| Alectra sessiliflora trnK gene, partial sequence; and maturase K
           (matK) gene, complete cds, chloroplast genes for
           chloroplast products
          Length = 2433

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  acctggattttccgacaaaa 68
           ||||||||||||||||||||
Sbjct: 828 acctggattttccgacaaaa 809
to top
>gb|AC069025.5| Homo sapiens chromosome 10 clone RP11-526G5, complete sequence
          Length = 211583

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   atgaatgaatgaaacaaatg 172
             ||||||||||||||||||||
Sbjct: 32300 atgaatgaatgaaacaaatg 32281
to top
>emb|BX571844.5| Zebrafish DNA sequence from clone DKEY-264L19 in linkage group 18,
             complete sequence
          Length = 148653

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   atgaatgaatgaaacaaatg 172
             ||||||||||||||||||||
Sbjct: 67474 atgaatgaatgaaacaaatg 67493
to top
>emb|BX470199.6| Zebrafish DNA sequence from clone CH211-226M7 in linkage group 11,
            complete sequence
          Length = 197146

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 153  atgaatgaatgaaacaaatg 172
            ||||||||||||||||||||
Sbjct: 6790 atgaatgaatgaaacaaatg 6771
to top
>emb|BX649610.5| Zebrafish DNA sequence from clone CH211-170D11 in linkage group 18,
              complete sequence
          Length = 150831

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 153    atgaatgaatgaaacaaatg 172
              ||||||||||||||||||||
Sbjct: 141585 atgaatgaatgaaacaaatg 141604
to top
>emb|BX537162.5| Zebrafish DNA sequence from clone DKEY-9A20 in linkage group 4, complete
              sequence
          Length = 223816

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    atgaatgaatgaaacaaatg 172
              ||||||||||||||||||||
Sbjct: 188728 atgaatgaatgaaacaaatg 188709
to top
>gb|AC104894.14| Mus musculus chromosome 1, clone RP23-290I22, complete sequence
          Length = 185038

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 146   acacagcatgaatgaatgaaacaa 169
             |||||| |||||||||||||||||
Sbjct: 47499 acacagaatgaatgaatgaaacaa 47522
to top
>gb|AY849604.1| Melasma scabrum maturase K (matK) gene, complete cds; chloroplast
          Length = 2441

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  acctggattttccgacaaaa 68
           ||||||||||||||||||||
Sbjct: 836 acctggattttccgacaaaa 817
to top
>gb|AY849601.1| Cycnium racemosum maturase K (matK) gene, complete cds; chloroplast
          Length = 2439

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  acctggattttccgacaaaa 68
           ||||||||||||||||||||
Sbjct: 830 acctggattttccgacaaaa 811
to top
>gb|AF489963.1| Striga gesnerioides maturase K (matK) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1531

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  acctggattttccgacaaaa 68
           ||||||||||||||||||||
Sbjct: 141 acctggattttccgacaaaa 122
to top
>gb|AF489962.1| Buchnera hispida maturase K (matK) gene, partial cds; chloroplast
           gene for chloroplast product
          Length = 1531

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  acctggattttccgacaaaa 68
           ||||||||||||||||||||
Sbjct: 141 acctggattttccgacaaaa 122
to top
>gb|AF489960.1| Alectra orobanchoides maturase K (matK) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1537

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  acctggattttccgacaaaa 68
           ||||||||||||||||||||
Sbjct: 141 acctggattttccgacaaaa 122
to top
>gb|AC134897.4| Mus musculus BAC clone RP23-459D9 from 6, complete sequence
          Length = 173574

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 85    tccatcccatcacctaacttctta 108
             |||| |||||||||||||||||||
Sbjct: 19709 tccagcccatcacctaacttctta 19732
to top
>gb|AC173339.1| Mus musculus BAC clone RP24-221C22 from chromosome 17, complete
            sequence
          Length = 166061

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 153  atgaatgaatgaaacaaatg 172
            ||||||||||||||||||||
Sbjct: 4973 atgaatgaatgaaacaaatg 4954
to top
>gb|AC153632.2| Mus musculus 6 BAC RP23-450O1 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 182517

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 85     tccatcccatcacctaacttctta 108
              |||| |||||||||||||||||||
Sbjct: 106349 tccagcccatcacctaacttctta 106372
to top
>gb|AC157811.3| Mus musculus chromosome 1, clone RP24-377C24, complete sequence
          Length = 188752

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 146   acacagcatgaatgaatgaaacaa 169
             |||||| |||||||||||||||||
Sbjct: 36827 acacagaatgaatgaatgaaacaa 36804
to top
>gb|AC169676.2| Mus musculus BAC clone RP24-163P20 from chromosome 17, complete
             sequence
          Length = 150204

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   atgaatgaatgaaacaaatg 172
             ||||||||||||||||||||
Sbjct: 27824 atgaatgaatgaaacaaatg 27843
to top
>emb|AJ429336.1|CSO429336 Cyclocheilon somaliense chloroplast matK gene for maturase
          Length = 1658

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 49 acctggattttccgacaaaa 68
          ||||||||||||||||||||
Sbjct: 62 acctggattttccgacaaaa 43
to top
>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 78      gccccggtccatcccatca 96
               |||||||||||||||||||
Sbjct: 1790834 gccccggtccatcccatca 1790852
to top
>gb|AC153356.5| Mus musculus BAC clone RP24-477I13 from chromosome 10, complete sequence
          Length = 207243

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 152    catgaatgaatgaaacaaa 170
              |||||||||||||||||||
Sbjct: 166546 catgaatgaatgaaacaaa 166564
to top
>ref|XM_516003.1| PREDICTED: Pan troglodytes similar to hypothetical protein
            (LOC459847), mRNA
          Length = 3675

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 160  aatgaaacaaatggtgagg 178
            |||||||||||||||||||
Sbjct: 3004 aatgaaacaaatggtgagg 3022
to top
>gb|AC117734.13| Mus musculus chromosome 1, clone RP24-130L9, complete sequence
          Length = 167235

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 143    catacacagcatgaatgaatgaa 165
              ||||||||| |||||||||||||
Sbjct: 153753 catacacagaatgaatgaatgaa 153731
to top
>gb|AC120877.15| Mus musculus chromosome 6, clone RP24-548D19, complete sequence
          Length = 228206

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 116   tatgtaacattatttgtgt 134
             |||||||||||||||||||
Sbjct: 25366 tatgtaacattatttgtgt 25384
to top
>gb|AC012650.9| Drosophila melanogaster clone BACN24N09, complete sequence
          Length = 74083

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 57923 atgaatgaatgaaacaaat 57941
to top
>gb|AC095825.6| Rattus norvegicus 4 BAC CH230-9J6 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 234084

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 147297 atgaatgaatgaaacaaat 147279
to top
>gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, complete sequence
          Length = 214580

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 153   atgaatgaatgaaacaaatggtg 175
             |||||||||||||| ||||||||
Sbjct: 66705 atgaatgaatgaaataaatggtg 66683
to top
>gb|AC129189.3| Mus musculus BAC clone RP24-67O22 from chromosome 15, complete sequence
          Length = 152947

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 115    atatgtaacattatttgtg 133
              |||||||||||||||||||
Sbjct: 147934 atatgtaacattatttgtg 147952
to top
>gb|AC118212.7| Mus musculus chromosome 6, clone RP24-170E4, complete sequence
          Length = 190612

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 138656 atgaatgaatgaaacaaat 138674
to top
>emb|AL929389.9| Zebrafish DNA sequence from clone CH211-51H4 in linkage group 11,
             complete sequence
          Length = 166353

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 117   atgtaacattatttgtgtc 135
             |||||||||||||||||||
Sbjct: 65301 atgtaacattatttgtgtc 65319
to top
>gb|AC122825.4| Mus musculus BAC clone RP23-209E13 from 10, complete sequence
          Length = 177676

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 152   catgaatgaatgaaacaaa 170
             |||||||||||||||||||
Sbjct: 87875 catgaatgaatgaaacaaa 87893
to top
>gb|AC004009.1| Homo sapiens PAC clone RP5-1103I5 from 7, complete sequence
          Length = 80765

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 58679 atgaatgaatgaaacaaat 58661
to top
>gb|AC102663.6| Mus musculus chromosome 6, clone RP23-244M15, complete sequence
          Length = 223742

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 116    tatgtaacattatttgtgt 134
              |||||||||||||||||||
Sbjct: 145521 tatgtaacattatttgtgt 145539
to top
>gb|AC159973.2| Mus musculus chromosome 1, clone RP24-207D15, complete sequence
          Length = 136567

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 143   catacacagcatgaatgaatgaa 165
             ||||||||| |||||||||||||
Sbjct: 63891 catacacagaatgaatgaatgaa 63869
to top
>emb|AL356240.15| Human DNA sequence from clone RP5-873F21 on chromosome 11 Contains part
             of a novel gene for brain protein 239, ESTs and GSSs,
             complete sequence
          Length = 114144

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 118   tgtaacattatttgtgtca 136
             |||||||||||||||||||
Sbjct: 68879 tgtaacattatttgtgtca 68897
to top
>emb|AL353751.13| Human DNA sequence from clone RP11-149I23 on chromosome 10 Contains the
             5' end of the LIPA gene for lipase A lysosomal acid
             cholesterol esterase (Wolman disease), a novel gene, the
             IFIT2 gene for interferon-induced protein with
             tetratricopeptide repeats 2, the IFIT4 gene for
             interferon-induced protein with tetratricopeptide repeats
             4, an interferon-induced protein with tetratricopeptide
             repeats 1 (IFIT1) pseudogene, the gene for a novel protein
             similar to interferon-induced protein with
             tetratricopeptide repeats 1 (IFIT1) and a CpG island,
             complete sequence
          Length = 169404

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 72615 atgaatgaatgaaacaaat 72633
to top
>emb|AL672216.10| Zebrafish DNA sequence from clone BUSM1-44O19 in linkage group 19
             Contains three novel transposase pseudogenes, a gene for a
             novel flotillin, a gene for a novel zinc finger protein,
             the knsl2 gene (kinesin-like protein 2), the znf297 gene
             (zinc finger protein 297), the 3' part of the daxx gene
             (death-associated protein 6) and a CpG island, complete
             sequence
          Length = 102704

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 66816 atgaatgaatgaaacaaat 66834
to top
>emb|CR927553.8| Zebrafish DNA sequence from clone DKEY-206P8 in linkage group 17,
            complete sequence
          Length = 162064

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 153  atgaatgaatgaaacaaat 171
            |||||||||||||||||||
Sbjct: 9093 atgaatgaatgaaacaaat 9075
to top
>emb|BX571703.10| Zebrafish DNA sequence from clone DKEY-188E21 in linkage group 20,
             complete sequence
          Length = 50908

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 48388 atgaatgaatgaaacaaat 48406
to top
>gb|AC101771.11| Mus musculus chromosome 15, clone RP24-104H19, complete sequence
          Length = 153992

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 115    atatgtaacattatttgtg 133
              |||||||||||||||||||
Sbjct: 107585 atatgtaacattatttgtg 107603
to top
>gb|AC096539.2| Homo sapiens chromosome 1 clone RP11-150L22, complete sequence
          Length = 183307

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 60625 atgaatgaatgaaacaaat 60643
to top
>emb|BX005412.17| Zebrafish DNA sequence from clone DKEY-23O4 in linkage group 16,
             complete sequence
          Length = 250962

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 49364 atgaatgaatgaaacaaat 49382
to top
>gb|AC021630.11| Mus musculus chromosome 14, clone RP23-178B24, complete sequence
          Length = 202804

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 173270 atgaatgaatgaaacaaat 173252
to top
>emb|BX664749.12| Zebrafish DNA sequence from clone DKEY-53M7 in linkage group 5, complete
              sequence
          Length = 181789

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 155658 atgaatgaatgaaacaaat 155640
to top
>gb|AC113266.24| Papio anubis clone rp41-106a4, complete sequence
          Length = 193032

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 179174 atgaatgaatgaaacaaat 179156
to top
>ref|NM_141175.2| Drosophila melanogaster Mes2 CG11100-RA, transcript variant A (Mes2),
            mRNA
          Length = 2438

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 121  aacattatttgtgtcagga 139
            |||||||||||||||||||
Sbjct: 1900 aacattatttgtgtcagga 1918
to top
>gb|AY060486.1| Drosophila melanogaster SD10763 full length cDNA
          Length = 2456

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 121  aacattatttgtgtcagga 139
            |||||||||||||||||||
Sbjct: 1900 aacattatttgtgtcagga 1918
to top
>emb|BX664616.16| Zebrafish DNA sequence from clone DKEY-231P15 in linkage group 8,
              complete sequence
          Length = 193090

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 143969 atgaatgaatgaaacaaat 143951
to top
>gb|AC160942.1| Pan troglodytes BAC clone CH251-443J9 from chromosome unknown, complete
             sequence
          Length = 182340

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 55161 atgaatgaatgaaacaaat 55143
to top
>gb|AC010607.8| Homo sapiens chromosome 5 clone CTB-28D11, complete sequence
          Length = 131098

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 147   cacagcatgaatgaatgaa 165
             |||||||||||||||||||
Sbjct: 79143 cacagcatgaatgaatgaa 79161
to top
>gb|AC011758.6|AC011758 Drosophila melanogaster, chromosome X, region 19C-19E, BAC clone
              BACR25I22, complete sequence
          Length = 164942

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 149153 atgaatgaatgaaacaaat 149135
to top
>emb|BX537276.5| Zebrafish DNA sequence from clone DKEYP-57A10 in linkage group 3,
              complete sequence
          Length = 165427

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 138233 atgaatgaatgaaacaaat 138251
to top
>gb|AC007476.5|AC007476 Drosophila melanogaster, chromosome 2R, region 49A-49B, BAC clone
             BACR37P06, complete sequence
          Length = 171705

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 108   acaccatatatgtaacattattt 130
             |||||||||| ||||||||||||
Sbjct: 74680 acaccatataggtaacattattt 74658
to top
>gb|AC009503.3| Homo sapiens BAC clone RP11-516K23 from 2, complete sequence
          Length = 201040

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 151   gcatgaatgaatgaaacaa 169
             |||||||||||||||||||
Sbjct: 23335 gcatgaatgaatgaaacaa 23353
to top
>gb|AC157527.2| Pan troglodytes BAC clone CH251-513D12 from chromosome unknown, complete
              sequence
          Length = 210196

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 194885 atgaatgaatgaaacaaat 194867
to top
>gb|AC146167.2| Pan troglodytes BAC clone RP43-1E11 from chromosome 7, complete sequence
          Length = 168862

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 153539 atgaatgaatgaaacaaat 153521
to top
>gb|AC017035.6| Homo sapiens BAC clone RP11-310J20 from 2, complete sequence
          Length = 154867

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 160   aatgaaacaaatggtgagg 178
             |||||||||||||||||||
Sbjct: 79522 aatgaaacaaatggtgagg 79504
to top
>gb|AF250284.1|AF250284 Amsacta moorei entomopoxvirus, complete genome
          Length = 232392

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 118    tgtaacattatttgtgtca 136
              |||||||||||||||||||
Sbjct: 144994 tgtaacattatttgtgtca 145012
to top
>emb|BX510916.7| Zebrafish DNA sequence from clone DKEY-208B17 in linkage group 5,
              complete sequence
          Length = 174866

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 114927 atgaatgaatgaaacaaat 114945
to top
>emb|AL954866.11| Zebrafish DNA sequence from clone CH211-10D23 in linkage group 23,
           complete sequence
          Length = 172741

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 153 atgaatgaatgaaacaaat 171
           |||||||||||||||||||
Sbjct: 667 atgaatgaatgaaacaaat 649
to top
>emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in linkage group 17,
              complete sequence
          Length = 180659

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 153    atgaatgaatgaaacaaatggtg 175
              |||||||||||||| ||||||||
Sbjct: 141098 atgaatgaatgaaataaatggtg 141120
to top
>emb|AL807785.7| Mouse DNA sequence from clone RP23-460B18 on chromosome X, complete
             sequence
          Length = 69447

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 143   catacacagcatgaatgaatgaa 165
             ||||||||| |||||||||||||
Sbjct: 26272 catacacagaatgaatgaatgaa 26250
to top
>gb|AC154837.2| Mus musculus BAC clone RP24-576O2 from 14, complete sequence
          Length = 134124

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 153   atgaatgaatgaaacaaat 171
             |||||||||||||||||||
Sbjct: 44381 atgaatgaatgaaacaaat 44363
to top
>gb|AC005720.6|AC005720 Drosophila melanogaster, chromosome 3L, region 79F1-80A2, BAC clone
             BACR48E05, complete sequence
          Length = 190390

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 121   aacattatttgtgtcagga 139
             |||||||||||||||||||
Sbjct: 81707 aacattatttgtgtcagga 81689
to top
>gb|AE003822.3| Drosophila melanogaster chromosome 2R, section 28 of 73 of the complete
             sequence
          Length = 233148

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 108   acaccatatatgtaacattattt 130
             |||||||||| ||||||||||||
Sbjct: 97806 acaccatataggtaacattattt 97784
to top
>gb|AE003599.2| Drosophila melanogaster chromosome 3L, section 80 of 83 of the complete
              sequence
          Length = 250029

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    aacattatttgtgtcagga 139
              |||||||||||||||||||
Sbjct: 154587 aacattatttgtgtcagga 154605
to top
>gb|AE003571.4| Drosophila melanogaster chromosome X, section 68 of 74 of the complete
              sequence
          Length = 302538

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 251345 atgaatgaatgaaacaaat 251327
to top
>dbj|AP003969.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-755E23, complete
             sequence
          Length = 163000

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 148   acagcatgaatgaatgaaacaaa 170
             ||||||||||||||| |||||||
Sbjct: 10315 acagcatgaatgaatcaaacaaa 10293
to top
>emb|BX248414.5| Zebrafish DNA sequence from clone CH211-236E8, complete sequence
          Length = 149603

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 122511 atgaatgaatgaaacaaat 122493
to top
>emb|CR847947.14| Zebrafish DNA sequence from clone DKEY-56M16 in linkage group 7, complete
              sequence
          Length = 205682

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 153    atgaatgaatgaaacaaatggtg 175
              |||||||||||||||||| ||||
Sbjct: 177497 atgaatgaatgaaacaaaaggtg 177475
to top
>emb|CR759821.9| Zebrafish DNA sequence from clone DKEY-190C14 in linkage group 5,
              complete sequence
          Length = 169089

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 153    atgaatgaatgaaacaaat 171
              |||||||||||||||||||
Sbjct: 101173 atgaatgaatgaaacaaat 101191
to top
>gb|AC170807.2| Mus musculus BAC clone RP23-374I2 from chromosome 17, complete sequence
          Length = 208318

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 143   catacacagcatgaatgaatgaa 165
             ||||||||| |||||||||||||
Sbjct: 26916 catacacagaatgaatgaatgaa 26894
to top
>gb|AC170884.3| Mus musculus BAC clone RP24-111L17 from chromosome 17, complete sequence
          Length = 180189

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 143    catacacagcatgaatgaatgaa 165
              ||||||||| |||||||||||||
Sbjct: 157451 catacacagaatgaatgaatgaa 157429
to top
>emb|AJ429326.1|ALO429326 Acanthus longifolius chloroplast partial matK gene for maturase
          Length = 1648

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 50 cctggattttccgacaaaa 68
          |||||||||||||||||||
Sbjct: 41 cctggattttccgacaaaa 23
to top
>emb|AL627128.16| Mouse DNA sequence from clone RP23-133J9 on chromosome 4, complete
              sequence
          Length = 183089

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 143    catacacagcatgaatgaatgaa 165
              ||||||||| |||||||||||||
Sbjct: 157000 catacacagaatgaatgaatgaa 157022
to top
>emb|AL139099.3|CNS01DX7 Human chromosome 14 DNA sequence BAC R-649E7 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 157010

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 153    atgaatgaatgaaacaaatggtg 175
              |||||||||||| ||||||||||
Sbjct: 143086 atgaatgaatgacacaaatggtg 143064
to top
>dbj|AB036638.1| Lycium elongatum chloroplast matK gene for maturase K, partial
          cds
          Length = 1179

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                 
Query: 46 atcacctggattttccgacaaaa 68
          |||||||||||||||| ||||||
Sbjct: 45 atcacctggattttccaacaaaa 23


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,148,598
Number of Sequences: 3902068
Number of extensions: 2148598
Number of successful extensions: 346331
Number of sequences better than 10.0: 120
Number of HSP's better than 10.0 without gapping: 120
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 345596
Number of HSP's gapped (non-prelim): 735
length of query: 196
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 174
effective length of database: 17,147,199,772
effective search space: 2983612760328
effective search space used: 2983612760328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top