ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl50d04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC006777.1| Caenorhabditis elegans cosmid Y46H3D, complete se... 44 0.41
2gb|AF038606.1| Caenorhabditis elegans cosmid C04C3, complete seq... 44 0.41
3emb|Z81030.1|CEC01G10 Caenorhabditis elegans Cosmid C01G10, comp... 44 0.41
4emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on ... 42 1.6
5gb|AC007546.6| Homo sapiens 12 BAC RP11-946P6 (Roswell Park Canc... 42 1.6
6emb|Z67754.1|CEC34E11 Caenorhabditis elegans Cosmid C34E11, comp... 42 1.6
7gb|AC119269.9| Mus musculus chromosome 5, clone RP24-324B22, com... 40 6.4
8gb|AC102454.7| Mus musculus chromosome 5, clone RP24-296L13, com... 40 6.4
9gb|AC117206.3| Mus musculus BAC clone RP23-260L17 from 5, comple... 40 6.4
10emb|Z97989.1|HS66H14 Human DNA sequence from clone RP1-66H14 on ... 40 6.4
11emb|BX571708.4| Zebrafish DNA sequence from clone DKEYP-74B2, co... 40 6.4
12gb|AC073427.7| Homo sapiens BAC clone RP11-746K19 from 4, comple... 40 6.4
13emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, ... 40 6.4
14gb|AC151714.3| Mus musculus BAC clone RP23-437A9 from chromosome... 40 6.4
15gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 40 6.4
16gb|AC137633.2| Homo sapiens 12 BAC RP11-113I1 (Roswell Park Canc... 40 6.4
17emb|AL929457.12| Zebrafish DNA sequence from clone CH211-153I8 i... 40 6.4 
>gb|AC006777.1| Caenorhabditis elegans cosmid Y46H3D, complete sequence
          Length = 27089

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 7     aaaactattagaggtggcaaactattagag 36
             ||||||||||||||||  ||||||||||||
Sbjct: 10616 aaaactattagaggtgcaaaactattagag 10645
to top
>gb|AF038606.1| Caenorhabditis elegans cosmid C04C3, complete sequence
          Length = 43947

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 7    aaaactattagaggtggcaaactattagag 36
            |||||||||||||||| ||||||| |||||
Sbjct: 2322 aaaactattagaggtgccaaactaatagag 2293
to top
>emb|Z81030.1|CEC01G10 Caenorhabditis elegans Cosmid C01G10, complete sequence
          Length = 38671

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 7     aaaactattagaggtggcaaactattagag 36
             |||||||||||||||| ||||||| |||||
Sbjct: 28018 aaaactattagaggtgccaaactaatagag 27989
to top
>emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 92472

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 398   agatgccccagacccagagca 418
             |||||||||||||||||||||
Sbjct: 76671 agatgccccagacccagagca 76691
to top
>gb|AC007546.6| Homo sapiens 12 BAC RP11-946P6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 168396

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 411   ccagagcatgtcatttcagaa 431
             |||||||||||||||||||||
Sbjct: 77625 ccagagcatgtcatttcagaa 77605
to top
>emb|Z67754.1|CEC34E11 Caenorhabditis elegans Cosmid C34E11, complete sequence
          Length = 39756

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 7     aaaactattagaggtggcaaactattagagatg 39
             ||||||||||||||||  |||||| ||||||||
Sbjct: 11388 aaaactattagaggtgcaaaactaatagagatg 11420
to top
>gb|AC119269.9| Mus musculus chromosome 5, clone RP24-324B22, complete sequence
          Length = 172282

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 415   agcatgtcatttcagaattcagat 438
             |||||||||||||||||| |||||
Sbjct: 54901 agcatgtcatttcagaatgcagat 54924
to top
>gb|AC102454.7| Mus musculus chromosome 5, clone RP24-296L13, complete sequence
          Length = 149588

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 166  gaatgcattccaatccatcc 185
            ||||||||||||||||||||
Sbjct: 2571 gaatgcattccaatccatcc 2552
to top
>gb|AC117206.3| Mus musculus BAC clone RP23-260L17 from 5, complete sequence
          Length = 183385

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    gaatgcattccaatccatcc 185
              ||||||||||||||||||||
Sbjct: 156496 gaatgcattccaatccatcc 156477
to top
>emb|Z97989.1|HS66H14 Human DNA sequence from clone RP1-66H14 on chromosome 6q21-22 Contains
             the 3' end of the FYN gene for the FYN oncogene related to
             SRC, FGR, YES and the 5' end of the C6orf5 gene for
             chromosome 6 open reading frame 5 (NFkB-activating protein
             ACT1, connection to IKK and SAPK/JNK, chromosome 6 open
             reading frame 6) (C6orf5)(ACT1, CIKS, C6ORF6,
             DKFZP586G0522)(contains FLJ22949), complete sequence
          Length = 155937

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    cctgttgttgaaaaccatac 100
             ||||||||||||||||||||
Sbjct: 74644 cctgttgttgaaaaccatac 74663
to top
>emb|BX571708.4| Zebrafish DNA sequence from clone DKEYP-74B2, complete sequence
          Length = 193197

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 264    gtagagtatatgcatgcatc 283
              ||||||||||||||||||||
Sbjct: 146680 gtagagtatatgcatgcatc 146661
to top
>gb|AC073427.7| Homo sapiens BAC clone RP11-746K19 from 4, complete sequence
          Length = 157152

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 259   gcaaagtagagtatatgcat 278
             ||||||||||||||||||||
Sbjct: 62713 gcaaagtagagtatatgcat 62694
to top
>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence
          Length = 143903

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ttgaaaaccatacaaaattc 107
             ||||||||||||||||||||
Sbjct: 77084 ttgaaaaccatacaaaattc 77065
to top
>gb|AC151714.3| Mus musculus BAC clone RP23-437A9 from chromosome 9, complete sequence
          Length = 217761

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 393   cctgcagatgccccagaccc 412
             ||||||||||||||||||||
Sbjct: 92341 cctgcagatgccccagaccc 92322
to top
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 276     catgcatcacggggtccggcttgagctg 303
               |||||||||||||| |||||| ||||||
Sbjct: 2472283 catgcatcacggggcccggctcgagctg 2472256
to top
>gb|AC137633.2| Homo sapiens 12 BAC RP11-113I1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 23301

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    gtggcaaactattagagatg 39
             ||||||||||||||||||||
Sbjct: 10836 gtggcaaactattagagatg 10817
to top
>emb|AL929457.12| Zebrafish DNA sequence from clone CH211-153I8 in linkage group 14,
             complete sequence
          Length = 164299

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 264   gtagagtatatgcatgcatc 283
             ||||||||||||||||||||
Sbjct: 64354 gtagagtatatgcatgcatc 64335


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,291,618
Number of Sequences: 3902068
Number of extensions: 4291618
Number of successful extensions: 77653
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77615
Number of HSP's gapped (non-prelim): 38
length of query: 471
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 449
effective length of database: 17,147,199,772
effective search space: 7699092697628
effective search space used: 7699092697628
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top