ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl50b11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP004492.1| Lotus japonicus genomic DNA, chromosome 4, clone... 44 0.066
2emb|Z48716.1|CEF59B10 Caenorhabditis elegans Cosmid F59B10, comp... 42 0.26
3emb|AL935147.9| Mouse DNA sequence from clone RP23-33O19 on chro... 42 0.26
4gb|AC162373.11| Mus musculus chromosome 18, clone RP23-410M11, c... 40 1.0
5gb|AC095999.8| Rattus norvegicus 4 BAC CH230-12B2 (Children's Ho... 40 1.0
6gb|AC161886.4| Pan troglodytes BAC clone CH251-708N9 from chromo... 40 1.0
7gb|AC184157.2| Pan troglodytes BAC clone CH251-31B9 from chromos... 40 1.0
8gb|AC184054.2| Pan troglodytes BAC clone CH251-706J5 from chromo... 40 1.0
9gb|AC126564.7| Homo sapiens 12 BAC RP11-638F5 (Roswell Park Canc... 40 1.0
10gb|AC087433.4|AC087433 Homo sapiens chromosome 15 clone RP11-101... 40 1.0
11gb|AC146074.4| Pan troglodytes BAC clone RP43-15D8 from chromoso... 40 1.0
12emb|AL357615.7|HS373D10 Homo sapiens chromosome 9 BAC RP11-373D1... 40 1.0
13emb|AL391667.19| Human DNA sequence from clone RP11-214L15 on ch... 40 1.0
14gb|AC102396.28| Mus musculus chromosome 3, clone RP24-169F23, co... 38 4.1
15gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome... 38 4.1
16gb|AY392539.1| Porcine teschovirus isolate UKG/170/80 polyprotei... 38 4.1
17gb|AY392534.1| Porcine teschovirus isolate DS 756/93 polyprotein... 38 4.1
18gb|AC147480.13| Mus musculus chromosome 14, clone RP23-429N24, c... 38 4.1
19gb|AC154527.2| Mus musculus BAC clone RP23-221K13 from chromosom... 38 4.1
20gb|AC115714.14| Mus musculus chromosome 12, clone RP23-477C24, c... 38 4.1
21gb|AC165092.3| Mus musculus BAC clone RP23-10M2 from chromosome ... 38 4.1
22gb|AC008163.2| Homo sapiens BAC clone RP11-5B9 from 7, complete ... 38 4.1
23emb|AL592463.10| Human DNA sequence from clone RP11-410K21 on ch... 38 4.1
24emb|AL162719.18| Human DNA sequence from clone RP11-461D23 on ch... 38 4.1
25gb|AC105180.8| Homo sapiens chromosome 8, clone RP11-345J1, comp... 38 4.1
26emb|BX294135.1| Pirellula sp. strain 1 complete genome; segment ... 38 4.1
27gb|AC131053.2| Homo sapiens chromosome 18, clone RP11-348G23, co... 38 4.1
28emb|BX323578.20| Zebrafish DNA sequence from clone DKEYP-81D2 in... 38 4.1
29gb|AC166091.3| Glycine max clone gmw1-11j16, complete sequence 38 4.1
30gb|AC099848.2| Homo sapiens chromosome 18, clone RP11-856F24, co... 38 4.1
31gb|AC067854.14| Homo sapiens chromosome 8, clone RP11-513H8, com... 38 4.1
32gb|AC090423.11| Homo sapiens Xp BAC RP11-86G5 (Roswell Park Canc... 38 4.1
33gb|AC026258.4| Homo sapiens chromosome 8, clone RP11-67N21, comp... 38 4.1
34gb|AC025679.4|AC025679 Homo sapiens chromosome 18, clone RP11-38... 38 4.1
35gb|AF296101.1|AF296101 Porcine teschovirus strain Sek 549/98 pol... 38 4.1
36gb|AF296091.1|AF296091 Porcine teschovirus strain PS 37 polyprot... 38 4.1
37emb|AL928927.10| Zebrafish DNA sequence from clone CH211-113H16,... 38 4.1
38emb|BX000475.6| Zebrafish DNA sequence from clone CH211-112P5, c... 38 4.1
39emb|BX908761.10| Zebrafish DNA sequence from clone DKEY-56M6 in ... 38 4.1
40emb|BX649644.5| Zebrafish DNA sequence from clone CH211-215N5 in... 38 4.1
41emb|Z71612.1|SCYNL336W S.cerevisiae chromosome XIV reading frame... 38 4.1
42emb|Z71611.1|SCYNL335W S.cerevisiae chromosome XIV reading frame... 38 4.1
43dbj|AP002848.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 38 4.1
44emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chr... 38 4.1
45emb|AL929535.6| Zebrafish DNA sequence from clone CH211-151O1, c... 38 4.1 
>dbj|AP004492.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT08D16, TM0025a,
            complete sequence
          Length = 51575

 Score = 44.1 bits (22), Expect = 0.066
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 52   aatcaaatttcactttgaaatg 73
            ||||||||||||||||||||||
Sbjct: 2106 aatcaaatttcactttgaaatg 2127
to top
>emb|Z48716.1|CEF59B10 Caenorhabditis elegans Cosmid F59B10, complete sequence
          Length = 27428

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 59    tttcactttgaaatgttacat 79
             |||||||||||||||||||||
Sbjct: 25727 tttcactttgaaatgttacat 25707
to top
>emb|AL935147.9| Mouse DNA sequence from clone RP23-33O19 on chromosome 2, complete
              sequence
          Length = 241249

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 66     ttgaaatgttacataaataat 86
              |||||||||||||||||||||
Sbjct: 132441 ttgaaatgttacataaataat 132461
to top
>gb|AC162373.11| Mus musculus chromosome 18, clone RP23-410M11, complete sequence
          Length = 173382

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 51     gaatcaaatttcactttgaaatgt 74
              ||||||||||||| ||||||||||
Sbjct: 107600 gaatcaaatttcagtttgaaatgt 107577
to top
>gb|AC095999.8| Rattus norvegicus 4 BAC CH230-12B2 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 217673

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 65     tttgaaatgttacataaata 84
              ||||||||||||||||||||
Sbjct: 181450 tttgaaatgttacataaata 181469
to top
>gb|AC161886.4| Pan troglodytes BAC clone CH251-708N9 from chromosome 7, complete
              sequence
          Length = 205419

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 59     tttcactttgaaatgttacataaataat 86
              |||| ||||||||||| |||||||||||
Sbjct: 187735 tttccctttgaaatgtcacataaataat 187708
to top
>gb|AC184157.2| Pan troglodytes BAC clone CH251-31B9 from chromosome 15, complete
              sequence
          Length = 167965

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 66     ttgaaatgttacataaataataga 89
              ||||||||||||||||| ||||||
Sbjct: 136889 ttgaaatgttacataaaaaataga 136866
to top
>gb|AC184054.2| Pan troglodytes BAC clone CH251-706J5 from chromosome 15, complete
             sequence
          Length = 177821

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 66    ttgaaatgttacataaataataga 89
             ||||||||||||||||| ||||||
Sbjct: 14591 ttgaaatgttacataaaaaataga 14614
to top
>gb|AC126564.7| Homo sapiens 12 BAC RP11-638F5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 121242

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 66    ttgaaatgttacataaataa 85
             ||||||||||||||||||||
Sbjct: 11611 ttgaaatgttacataaataa 11592
to top
>gb|AC087433.4|AC087433 Homo sapiens chromosome 15 clone RP11-101J17 and RP11-501G11 map 15q21.1,
              complete sequence
          Length = 185145

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 66     ttgaaatgttacataaataataga 89
              ||||||||||||||||| ||||||
Sbjct: 113538 ttgaaatgttacataaaaaataga 113561
to top
>gb|AC146074.4| Pan troglodytes BAC clone RP43-15D8 from chromosome 7, complete sequence
          Length = 196799

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 59     tttcactttgaaatgttacataaataat 86
              |||| ||||||||||| |||||||||||
Sbjct: 180873 tttccctttgaaatgtcacataaataat 180846
to top
>emb|AL357615.7|HS373D10 Homo sapiens chromosome 9 BAC RP11-373D10, complete sequence
          Length = 171446

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    aaatgttacataaataatag 88
             ||||||||||||||||||||
Sbjct: 55753 aaatgttacataaataatag 55734
to top
>emb|AL391667.19| Human DNA sequence from clone RP11-214L15 on chromosome 9, complete
             sequence
          Length = 110444

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    aaatgttacataaataatag 88
             ||||||||||||||||||||
Sbjct: 23070 aaatgttacataaataatag 23051
to top
>gb|AC102396.28| Mus musculus chromosome 3, clone RP24-169F23, complete sequence
          Length = 137155

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 60    ttcactttgaaatgttacataaa 82
             |||||||||| ||||||||||||
Sbjct: 68549 ttcactttgacatgttacataaa 68527
to top
>gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome 12, complete
            sequence
          Length = 199262

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 71   atgttacataaataataga 89
            |||||||||||||||||||
Sbjct: 9503 atgttacataaataataga 9521
to top
>gb|AY392539.1| Porcine teschovirus isolate UKG/170/80 polyprotein gene, partial
           cds
          Length = 3300

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 41  gtcatcccaagaatcaaat 59
           |||||||||||||||||||
Sbjct: 711 gtcatcccaagaatcaaat 729
to top
>gb|AY392534.1| Porcine teschovirus isolate DS 756/93 polyprotein gene, partial cds
          Length = 3721

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 41  gtcatcccaagaatcaaat 59
           |||||||||||||||||||
Sbjct: 735 gtcatcccaagaatcaaat 753
to top
>gb|AC147480.13| Mus musculus chromosome 14, clone RP23-429N24, complete sequence
          Length = 210000

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 63   actttgaaatgttacataa 81
            |||||||||||||||||||
Sbjct: 2991 actttgaaatgttacataa 2973
to top
>gb|AC154527.2| Mus musculus BAC clone RP23-221K13 from chromosome 14, complete
             sequence
          Length = 215802

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    actttgaaatgttacataa 81
             |||||||||||||||||||
Sbjct: 82563 actttgaaatgttacataa 82581
to top
>gb|AC115714.14| Mus musculus chromosome 12, clone RP23-477C24, complete sequence
          Length = 164272

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    atgttacataaataataga 89
             |||||||||||||||||||
Sbjct: 36071 atgttacataaataataga 36053
to top
>gb|AC165092.3| Mus musculus BAC clone RP23-10M2 from chromosome 14, complete sequence
          Length = 215949

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    actttgaaatgttacataa 81
             |||||||||||||||||||
Sbjct: 16426 actttgaaatgttacataa 16408
to top
>gb|AC008163.2| Homo sapiens BAC clone RP11-5B9 from 7, complete sequence
          Length = 135300

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 56    aaatttcactttgaaatgttaca 78
             |||||||||||| ||||||||||
Sbjct: 57312 aaatttcactttaaaatgttaca 57290
to top
>emb|AL592463.10| Human DNA sequence from clone RP11-410K21 on chromosome 9 Contains the
             5' end of the gene for the likely ortholog of mouse
             polydom (POLYDOM), a novel gene and a CpG island, complete
             sequence
          Length = 96779

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 57    aatttcactttgaaatgtt 75
             |||||||||||||||||||
Sbjct: 71312 aatttcactttgaaatgtt 71330
to top
>emb|AL162719.18| Human DNA sequence from clone RP11-461D23 on chromosome 6 Contains part
             of a putative novel transcript, complete sequence
          Length = 91219

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 70    aatgttacataaataatag 88
             |||||||||||||||||||
Sbjct: 86433 aatgttacataaataatag 86451
to top
>gb|AC105180.8| Homo sapiens chromosome 8, clone RP11-345J1, complete sequence
          Length = 174617

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 58     atttcactttgaaatgtta 76
              |||||||||||||||||||
Sbjct: 160593 atttcactttgaaatgtta 160611
to top
>emb|BX294135.1| Pirellula sp. strain 1 complete genome; segment 3/24
          Length = 340750

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 40     ggtcatcccaagaatcaaa 58
              |||||||||||||||||||
Sbjct: 188914 ggtcatcccaagaatcaaa 188896
to top
>gb|AC131053.2| Homo sapiens chromosome 18, clone RP11-348G23, complete sequence
          Length = 191115

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 45     tcccaagaatcaaatttca 63
              |||||||||||||||||||
Sbjct: 100196 tcccaagaatcaaatttca 100178
to top
>emb|BX323578.20| Zebrafish DNA sequence from clone DKEYP-81D2 in linkage group 14,
              complete sequence
          Length = 214676

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 65     tttgaaatgttacataaataata 87
              |||||||||||||| ||||||||
Sbjct: 176853 tttgaaatgttacacaaataata 176875
to top
>gb|AC166091.3| Glycine max clone gmw1-11j16, complete sequence
          Length = 69947

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    actttgaaatgttacataa 81
             |||||||||||||||||||
Sbjct: 28526 actttgaaatgttacataa 28508
to top
>gb|AC099848.2| Homo sapiens chromosome 18, clone RP11-856F24, complete sequence
          Length = 132288

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    tcccaagaatcaaatttca 63
             |||||||||||||||||||
Sbjct: 34283 tcccaagaatcaaatttca 34265
to top
>gb|AC067854.14| Homo sapiens chromosome 8, clone RP11-513H8, complete sequence
          Length = 203982

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 58    atttcactttgaaatgtta 76
             |||||||||||||||||||
Sbjct: 43295 atttcactttgaaatgtta 43313
to top
>gb|AC090423.11| Homo sapiens Xp BAC RP11-86G5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 104901

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 50    agaatcaaatttcactttg 68
             |||||||||||||||||||
Sbjct: 94209 agaatcaaatttcactttg 94191
to top
>gb|AC026258.4| Homo sapiens chromosome 8, clone RP11-67N21, complete sequence
          Length = 170676

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 67     tgaaatgttacataaataa 85
              |||||||||||||||||||
Sbjct: 118773 tgaaatgttacataaataa 118791
to top
>gb|AC025679.4|AC025679 Homo sapiens chromosome 18, clone RP11-383C19, complete sequence
          Length = 166937

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    tcccaagaatcaaatttca 63
             |||||||||||||||||||
Sbjct: 59883 tcccaagaatcaaatttca 59901
to top
>gb|AF296101.1|AF296101 Porcine teschovirus strain Sek 549/98 polyprotein gene, partial cds
          Length = 3434

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 41  gtcatcccaagaatcaaat 59
           |||||||||||||||||||
Sbjct: 459 gtcatcccaagaatcaaat 477
to top
>gb|AF296091.1|AF296091 Porcine teschovirus strain PS 37 polyprotein gene, complete cds
          Length = 7018

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 41  gtcatcccaagaatcaaat 59
           |||||||||||||||||||
Sbjct: 709 gtcatcccaagaatcaaat 727
to top
>emb|AL928927.10| Zebrafish DNA sequence from clone CH211-113H16, complete sequence
          Length = 168805

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 68    gaaatgttacataaataat 86
             |||||||||||||||||||
Sbjct: 49185 gaaatgttacataaataat 49203
to top
>emb|BX000475.6| Zebrafish DNA sequence from clone CH211-112P5, complete sequence
          Length = 156271

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 65     tttgaaatgttacataaataata 87
              |||||||||||||| ||||||||
Sbjct: 133888 tttgaaatgttacacaaataata 133910
to top
>emb|BX908761.10| Zebrafish DNA sequence from clone DKEY-56M6 in linkage group 18,
             complete sequence
          Length = 47038

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 57    aatttcactttgaaatgtt 75
             |||||||||||||||||||
Sbjct: 30503 aatttcactttgaaatgtt 30521
to top
>emb|BX649644.5| Zebrafish DNA sequence from clone CH211-215N5 in linkage group 18,
              complete sequence
          Length = 120810

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 57     aatttcactttgaaatgtt 75
              |||||||||||||||||||
Sbjct: 106431 aatttcactttgaaatgtt 106413
to top
>emb|Z71612.1|SCYNL336W S.cerevisiae chromosome XIV reading frame ORF YNL336w
          Length = 4061

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 54   tcaaatttcactttgaaat 72
            |||||||||||||||||||
Sbjct: 2696 tcaaatttcactttgaaat 2714
to top
>emb|Z71611.1|SCYNL335W S.cerevisiae chromosome XIV reading frame ORF YNL335w
          Length = 2732

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  tcaaatttcactttgaaat 72
           |||||||||||||||||||
Sbjct: 611 tcaaatttcactttgaaat 629
to top
>dbj|AP002848.2| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1670H7
          Length = 183125

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 67    tgaaatgttacataaataa 85
             |||||||||||||||||||
Sbjct: 77814 tgaaatgttacataaataa 77796
to top
>emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chromosome 14, complete
             sequence
          Length = 194408

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 57    aatttcactttgaaatgtt 75
             |||||||||||||||||||
Sbjct: 69081 aatttcactttgaaatgtt 69099
to top
>emb|AL929535.6| Zebrafish DNA sequence from clone CH211-151O1, complete sequence
          Length = 162436

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     aaatgttacataaataata 87
              |||||||||||||||||||
Sbjct: 156236 aaatgttacataaataata 156254


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,090,534
Number of Sequences: 3902068
Number of extensions: 1090534
Number of successful extensions: 85237
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85153
Number of HSP's gapped (non-prelim): 84
length of query: 94
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 73
effective length of database: 17,151,101,840
effective search space: 1252030434320
effective search space used: 1252030434320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top