ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl50b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
2gb|AF271995.1|AF271995 Oryza sativa phosphoenolpyruvate carboxyl... 214 2e-52
3dbj|AP004117.3| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
4dbj|AK065425.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
5dbj|AK065029.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
6dbj|AK062201.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
7emb|AJ318341.1|SSP318341 Saccharum hybrid cultivar R570 partial ... 168 9e-39
8gb|AY109352.1| Zea mays CL1793_1 mRNA sequence 168 9e-39
9dbj|AB012228.1| Zea mays mRNA for phosphoenolpyruvate carboxylas... 168 9e-39
10gb|BT017928.1| Zea mays clone EL01N0519G10.c mRNA sequence 165 1e-37
11emb|AJ318340.1|SSP318340 Saccharum hybrid cultivar R570 partial ... 161 2e-36
12emb|AJ318339.1|SSP318339 Saccharum hybrid cultivar R570 partial ... 161 2e-36
13emb|X65137.1|SVPEPCGX S.vulgare pepC gene for PEP carboxylase 151 2e-33
14emb|X55664.1|SVPEPCA Sorghum vulgare mRNA for phosphoenolpyruvat... 151 2e-33
15emb|AJ318583.1|VZI318583 Vetiveria zizanioides partial 3' end mR... 119 7e-24
16gb|AY251482.1| Echinochloa crus-galli phosphoenolpyruvate carbox... 119 7e-24
17gb|AF271162.1| Hydrilla verticillata phosphoenolpyruvate carboxy... 117 3e-23
18emb|AJ293347.1|SVE293347 Sorghum verticilliflorum partial mRNA f... 111 2e-21
19emb|AJ318582.1|EAU318582 Eulalia aurea partial 3' end mRNA for p... 103 4e-19
20gb|AF271161.2| Hydrilla verticillata phosphoenolpyruvate carboxy... 101 2e-18
21emb|X15239.1|ZMPEPC1G Maize PEPC1 gene for phosphoenolpyruvate c... 101 2e-18
22emb|X15238.1|ZMPEPC1 Maize mRNA for phosphoenolpyruvate carboxyl... 101 2e-18
23emb|X15642.1|ZMPEP Z.mays gene for phosphoenolpyruvate carboxyla... 101 2e-18
24gb|AY103747.1| Zea mays PCO070206 mRNA sequence 101 2e-18
25emb|AJ536629.1|ZMA536629 Zea mays mRNA for phosphoenolpyruvate c... 98 3e-17
26gb|AF271163.1| Hydrilla verticillata phosphoenolpyruvate carboxy... 94 4e-16
27ref|NM_188892.2| Oryza sativa (japonica cultivar-group), mRNA 92 2e-15
28ref|XM_507204.1| PREDICTED Oryza sativa (japonica cultivar-group... 92 2e-15
29dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
30dbj|AP003913.3| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
31dbj|AK073703.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
32dbj|AK070742.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
33dbj|AK067572.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
34dbj|AK061683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
35gb|AY187619.1| Oryza sativa (indica cultivar-group) phosphoenolp... 92 2e-15
36gb|AY491400.1| Setaria italica C3 phosphoenolpyruvate carboxylas... 90 7e-15
37emb|X63756.1|SVPEPCAA S.vulgare PEPC gene 90 7e-15
38emb|X17379.1|SVPEPC Sorghum vulgare mRNA for phosphoenolpyruvate... 90 7e-15
39gb|M86661.1|SCFSCPEPCD Saccharum hybrid cultivar H32-8560 phosph... 88 3e-14
40emb|AJ318338.1|SSP318338 Saccharum spontaneum mRNA for putative ... 88 3e-14
41emb|AJ293348.1|CLA293348 Coix lacryma-jobi partial mRNA for puta... 88 3e-14
42emb|AJ252923.1|KSAJ2923 Kalanchoe streptantha partial mRNA for p... 88 3e-14
43emb|AJ231303.1|KSAJ1303 Kalanchoe streptantha partial mRNA for p... 88 3e-14
44ref|NM_191306.1| Oryza sativa (japonica cultivar-group), predic... 86 1e-13
45emb|X03613.1|ZMPEPCR Maize mRNA for phosphoenolpyruvate carboxyl... 86 1e-13
46dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
47dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
48dbj|AP003409.4| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
49dbj|AP005802.3| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
50dbj|AK101274.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
51dbj|AK070480.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
52gb|AY111910.1| Zea mays CL16446_1 mRNA sequence 86 1e-13
53gb|AY107882.1| Zea mays PCO089178 mRNA sequence 86 1e-13
54dbj|AB055075.1| Oryza sativa (japonica cultivar-group) mRNA for ... 86 1e-13
55emb|Z68125.1|AHC4PHPEC A.hypochondriacus mRNA for C4 photosynthe... 78 3e-11
56emb|AJ300742.1|PAM300742 Phalaenopsis amabilis partial ppc gene ... 78 3e-11
57gb|AF288382.1|AF288382 Phaseolus vulgaris phosphoenolpyruvate ca... 78 3e-11
58gb|L49175.1|AMHCPPC Amaranthus hypochondriacus C4 photosynthetic... 78 3e-11
59dbj|AB097088.1| Glycine max GmPEPC7 gene for phosphoenolpyruvate... 76 1e-10
60dbj|AB008540.1| Glycine max mRNA for phosphoenolpyruvate carboxy... 76 1e-10
61emb|X59925.1|SVPEPCG S.vulgare PEPC gene for phosphoenolpyruvate... 74 4e-10
62emb|AJ312665.1|SAP312665 Solenangis aphylla partial mRNA for pho... 74 4e-10
63emb|AJ312632.1|KDA312632 Kalanchoe daigremontiana partial mRNA f... 74 4e-10
64gb|AY135709.1| Saccharum hybrid cultivar putative C4 phosphoenol... 72 2e-09
65emb|X87820.1|KBRNAPPC3 K.blossfeldiana mRNA for phosphoenolpyruv... 72 2e-09
66emb|AJ293346.1|SOF293346 Saccharum officinarum mRNA for putative... 72 2e-09
67emb|AJ252946.1|KGAJ2946 Kalanchoe gracilipes partial mRNA for ph... 72 2e-09
68emb|AJ231288.1|KGAJ1288 Kalanchoe gracilipes partial mRNA for ph... 72 2e-09
69gb|AF495586.1| Setaria italica putative C4 phosphoenolpyruvate c... 72 2e-09
70gb|AF494192.1| Flaveria pubescens phosphoenolpyruvate carboxylas... 70 6e-09
71gb|AF494191.1| Flaveria brownii phosphoenolpyruvate carboxylase ... 70 6e-09
72emb|Z71974.1|FTPPCB F.trinervia ppcB gene (partial) 70 6e-09
73emb|Z71973.1|FPPPCB F.pringlei ppcB gene (partial) 70 6e-09
74emb|X87821.1|KBRNAPCC4 K.blossfeldiana mRNA for phosphoenolpyruv... 70 6e-09
75emb|AJ312678.1|KFE312678 Kalanchoe fedtschenkoi partial mRNA for... 70 6e-09
76emb|AJ300741.1|PEQ300741 Phalaenopsis equestris partial ppc gene... 70 6e-09
77emb|AJ286750.1|SRO286750 Sesbania rostrata mRNA for phosphoenolp... 70 6e-09
78emb|AJ252917.1|KTAJ2917 Kalanchoe tomentosa partial mRNA for pho... 70 6e-09
79emb|AJ252916.1|KTAJ2916 Kalanchoe tomentosa partial mRNA for pho... 70 6e-09
80emb|AJ231290.1|LJAJ1290 Leucobryum juniperoideum partial mRNA fo... 70 6e-09
81gb|AF248079.1|AF248079 Flaveria trinervia phosphoenolpyruvate ca... 70 6e-09
82dbj|AB097087.1| Glycine max GmPEPC15 gene for phosphoenolpyruvat... 70 6e-09
83dbj|D13998.1|SOYPEPC Glycine max gmppc1 mRNA for phosphoenolpyru... 70 6e-09
84gb|U65227.1|HVU65227 Hydrilla verticillata phosphoenolpyruvate c... 70 6e-09
85dbj|AB008542.1| Glycine max mRNA for phosphoenolpyruvate carboxy... 70 6e-09
86emb|X91631.1|AEPPCGENE A.eburneum mRNA for phosphoenolpyruvate c... 68 2e-08
87emb|AJ252947.1|KPAJ2947 Kalanchoe petitiana partial mRNA for pho... 68 2e-08
88emb|AJ231295.1|KPAJ1295 Kalanchoe petitiana partial mRNA for pho... 68 2e-08
89dbj|AB078718.1| Nicotiana sylvestris Nsppc1 gene for phosphoenol... 68 2e-08
90ref|NM_188369.1| Oryza sativa (japonica cultivar-group), predic... 66 1e-07
91emb|X91406.1|TUPPC T.usneoides mRNA for phosphoenolpyruvate deca... 66 1e-07
92emb|AJ312683.1|KFE312683 Kalanchoe fedtschenkoi partial mRNA for... 66 1e-07
93emb|AJ312681.1|KFE312681 Kalanchoe fedtschenkoi partial mRNA for... 66 1e-07
94emb|AJ312680.1|KFE312680 Kalanchoe fedtschenkoi partial mRNA for... 66 1e-07
95emb|AJ312633.1|KDA312633 Kalanchoe daigremontiana partial mRNA f... 66 1e-07
96emb|AJ417435.1|CSA417435 Cucumis sativus partial mRNA for phosph... 66 1e-07
97emb|AJ252945.1|KGAJ2945 Kalanchoe grandiflora partial mRNA for p... 66 1e-07
98emb|AJ252924.1|KSAJ2924 Kalanchoe streptantha partial mRNA for p... 66 1e-07
99emb|AJ252914.1|KKAJ2914 Kalanchoe kewensis partial mRNA for phos... 66 1e-07
100emb|AJ231296.1|PFAJ1296 Polytrichum formosum partial mRNA for ph... 66 1e-07
101emb|AJ231294.1|PCAJ1294 Polytrichum commune partial mRNA for pho... 66 1e-07
102dbj|AP003052.3| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
103dbj|AK066635.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
104emb|Y15897.1|TAPEPC Triticum aestivum mRNA for phosphoenolpyruva... 64 4e-07
105emb|X61489.1|ZMPHOPCAR Zea mays pep gene for (C3 type) phosphoen... 64 4e-07
106emb|AJ231284.1|DSAJ1284 Dicranum scoparium partial mRNA for phos... 64 4e-07
107emb|AJ312670.1|LBI312670 Leptotes bicolor partial mRNA for phosp... 64 4e-07
108emb|AJ312660.1|ETI312660 Euphorbia tirucalli partial mRNA for ph... 64 4e-07
109emb|AJ252928.1|VAAJ2928 Vanilla aphylla partial mRNA for phospho... 64 4e-07
110gb|AF008940.1|AF008940 Gossypium hirsutum phosphoenolpyruvate ca... 64 4e-07
111gb|AC125474.16| Medicago truncatula clone mth2-16l11, complete s... 62 2e-06
112gb|AC135231.23| Medicago truncatula clone mth2-28m10, complete s... 62 2e-06
113emb|Z71976.1|FTPPCC F.trinervia ppcC gene (partial) 62 2e-06
114emb|Z48966.1|FPPPCAMR F.pringlei ppcA mRNA for phosphoenolpyruva... 62 2e-06
115emb|Z25853.1|FAPHOCAR F.australasica mRNA for phosphoenolpyruvat... 62 2e-06
116emb|X95856.1|NAPPC1 Neoregelia ampullacea mRNA for phosphoenolpy... 62 2e-06
117emb|X87149.1|VPPPCGE1 V.planifolia mRNA for phosphoenolpyruvate ... 62 2e-06
118emb|X64144.2|FPPPCA Flaveria pringlei ppcA1 gene for phosphoenol... 62 2e-06
119emb|X64143.2|FTPPCA Flaveria trinervia ppcA1 gene for phosphoeno... 62 2e-06
120emb|X61304.1|FTPEPC F.trinervia mRNA for phosphoenolpyruvate car... 62 2e-06
121emb|X59016.1|NTPPC N.tabacum mRNA for phosphoenolpyruvate carbox... 62 2e-06
122emb|AJ312663.1|MEX312663 Microcoelia exilis partial mRNA for pho... 62 2e-06
123emb|AJ312644.1|MCR312644 Mesembryanthemum crystallinum partial m... 62 2e-06
124emb|AJ417436.1|CSA417436 Cucumis sativus partial mRNA for phosph... 62 2e-06
125emb|AJ252926.1|KPAJ2926 Kalanchoe petitiana partial mRNA for pho... 62 2e-06
126emb|AJ231289.1|LCAJ1289 Lunularia cruciata partial mRNA for phos... 62 2e-06
127emb|AJ011302.1|VFA011302 Vicia faba mRNA for phosphoenolpyruvate... 62 2e-06
128gb|AF512995.1| Citrus junos phosphoenolpyruvate carboxylase (pep... 62 2e-06
129gb|AF248080.1|AF248080 Flaveria trinervia phosphoenolpyruvate ca... 62 2e-06
130emb|AM237200.1| Lupinus luteus mRNA for phosphoenolpyrovate carb... 62 2e-06
131gb|AF135371.1|AF135371 Lotus corniculatus phosphoenol pyruvate c... 62 2e-06
132gb|M83086.1|ALFPPPCA Medicago sativa phosphoenolpyruvate carboxy... 62 2e-06
133gb|L39371.1|ALFPEPC Medicago sativa phosphoenolpyruvate carboxyl... 62 2e-06
134dbj|D64037.1|PEASPARKLE Pea mRNA for phosphoenolpyruvate carboxy... 62 2e-06
135gb|AC121246.28| Medicago truncatula clone mth2-35m8, complete se... 60 6e-06
136emb|X91636.1|AEPPCGEN1 A.eburneum mRNA for phosphoenolpyruvate c... 60 6e-06
137emb|X91632.1|SAPPCGENE S.aphylla mRNA for phosphoenolpyruvate ca... 60 6e-06
138gb|DQ320104.1| Clusia hilariana phosphoenolpyruvate carboxylase ... 60 6e-06
139emb|AJ312664.1|SAP312664 Solenangis aphylla partial mRNA for pho... 60 6e-06
140emb|AJ312639.1|CUV312639 Clusia uvitana partial mRNA for phospho... 60 6e-06
141emb|AJ312638.1|CUV312638 Clusia uvitana partial mRNA for phospho... 60 6e-06
142emb|AJ312627.1|VPL312627 Vanilla planifolia partial mRNA for pho... 60 6e-06
143dbj|AB078719.1| Nicotiana sylvestris Nsppc2 gene for phosphoenol... 60 6e-06
144emb|AJ318342.1|SSP318342 Saccharum hybrid cultivar R570 partial ... 58 2e-05
145emb|AJ007705.1|TAE7705 Triticum aestivum PEPC gene 58 2e-05
146emb|X90982.1|STPPC1 S.tuberosum ppc1 gene 58 2e-05
147emb|AJ312682.1|KFE312682 Kalanchoe fedtschenkoi partial mRNA for... 58 2e-05
148emb|AJ312672.1|LBI312672 Leptotes bicolor partial mRNA for phosp... 58 2e-05
149emb|AJ312671.1|LBI312671 Leptotes bicolor partial mRNA for phosp... 58 2e-05
150emb|AJ312668.1|LBI312668 Leptotes bicolor partial mRNA for phosp... 58 2e-05
151emb|AJ312656.1|TUS312656 Tillandsia usneoides partial mRNA for p... 58 2e-05
152emb|AJ312646.1|KPI312646 Kalanchoe pinnata partial mRNA for phos... 58 2e-05
153emb|AJ312634.1|KDA312634 Kalanchoe daigremontiana partial mRNA f... 58 2e-05
154emb|AJ312617.1|CRE312617 Cycas revoluta partial mRNA for phospho... 58 2e-05
155emb|AJ344052.1|KPI344052 Kalanchoe pinnata partial mRNA for phos... 58 2e-05
156emb|AJ318343.1|SSP318343 Saccharum hybrid cultivar R570 partial ... 58 2e-05
157emb|AJ252944.1|DDAJ2944 Dendrobium delicatum partial mRNA for ph... 58 2e-05
158emb|AJ252922.1|KPAJ2922 Kalanchoe pinnata partial mRNA for phosp... 58 2e-05
159emb|AJ252920.1|KPAJ2920 Kalanchoe pinnata partial mRNA for phosp... 58 2e-05
160emb|AJ252919.1|KPAJ2919 Kalanchoe pinnata partial mRNA for phosp... 58 2e-05
161emb|AJ252915.1|KKAJ2915 Kalanchoe kewensis partial mRNA for phos... 58 2e-05
162emb|AJ231291.1|LPAJ1291 Leptobryum pyriforme partial mRNA for ph... 58 2e-05
163dbj|D10717.1|SOYGMPPC Glycine max mRNA for phosphoenolpyruvate c... 58 2e-05
164gb|AY349322.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ... 56 9e-05
165gb|AY349321.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 ... 56 9e-05
166gb|AY349316.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 56 9e-05
167gb|AY349312.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 56 9e-05
168gb|AY349311.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 56 9e-05
169gb|AY349310.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 56 9e-05
170gb|AY349308.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 56 9e-05
171gb|AY349306.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 56 9e-05
172gb|AY349304.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 56 9e-05
173gb|AY349303.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 56 9e-05
174gb|AY349302.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 56 9e-05
175gb|AY349298.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 56 9e-05
176emb|X87819.1|KBRNAPPC2 K.blossfeldiana mRNA for phosphoenolpyruv... 56 9e-05
177emb|X87818.1|KBRNAPPC1 K.blossfeldiana mRNA for phosphoenolpyruv... 56 9e-05
178emb|X14587.1|MCPPCA Mesembryanthemum crystallinum ppc1 gene for ... 56 9e-05
179emb|X13660.1|MCPPCR Mesembryanthemum crystallinum mRNA for phosp... 56 9e-05
180emb|AJ312661.1|MEX312661 Microcoelia exilis partial mRNA for pho... 56 9e-05
181emb|AJ312654.1|TUS312654 Tillandsia usneoides partial mRNA for p... 56 9e-05
182emb|AJ312653.1|TUS312653 Tillandsia usneoides partial mRNA for p... 56 9e-05
183emb|AJ312643.1|MCR312643 Mesembryanthemum crystallinum partial m... 56 9e-05
184emb|AJ312642.1|MCR312642 Mesembryanthemum crystallinum partial m... 56 9e-05
185emb|AJ312640.1|MCR312640 Mesembryanthemum crystallinum partial m... 56 9e-05
186emb|AJ312624.1|VPL312624 Vanilla planifolia partial mRNA for pho... 56 9e-05
187emb|AJ252932.1|VPAJ2932 Vanilla phalaenopsis partial mRNA for ph... 56 9e-05
188emb|AJ252930.1|VPAJ2930 Vanilla phalaenopsis partial mRNA for ph... 56 9e-05
189emb|AJ252927.1|VAAJ2927 Vanilla aphylla partial mRNA for phospho... 56 9e-05
190emb|AJ252921.1|KPAJ2921 Kalanchoe pinnata partial mRNA for phosp... 56 9e-05
191gb|AY663388.1| Lupinus albus phosphoenolpyruvate carboxylase 4 m... 56 9e-05
192gb|AY663387.1| Lupinus albus phosphoenolpyruvate carboxylase 3 m... 56 9e-05
193emb|X95861.1|VPPPC1 Vanilla planifolia mRNA for phosphoenolpyruv... 54 4e-04
194emb|X14588.1|MCPPCB Mesembryanthemum crystallinum ppc2 gene for ... 54 4e-04
195gb|DQ320106.1| Clusia multiflora phosphoenolpyruvate carboxylase... 54 4e-04
196gb|DQ320105.1| Clusia minor phosphoenolpyruvate carboxylase (pep... 54 4e-04
197gb|DQ320102.1| Clusia hilariana phosphoenolpyruvate carboxylase ... 54 4e-04
198gb|AY950667.1| Alternanthera sessilis phosphoenolpyruvate carbox... 54 4e-04
199emb|AJ312679.1|KFE312679 Kalanchoe fedtschenkoi partial mRNA for... 54 4e-04
200emb|AJ312662.1|MEX312662 Microcoelia exilis partial mRNA for pho... 54 4e-04
201emb|AJ312649.1|KPI312649 Kalanchoe pinnata partial mRNA for phos... 54 4e-04
202emb|AJ312647.1|KPI312647 Kalanchoe pinnata partial mRNA for phos... 54 4e-04
203emb|AJ312626.1|VPL312626 Vanilla planifolia partial mRNA for pho... 54 4e-04
204emb|AJ344055.1|KPI344055 Kalanchoe pinnata partial mRNA for phos... 54 4e-04
205emb|AJ344053.1|KPI344053 Kalanchoe pinnata partial mRNA for phos... 54 4e-04
206emb|AJ252925.1|KSAJ2925 Kalanchoe streptantha partial mRNA for p... 54 4e-04
207emb|AJ011303.1|VFA011303 Vicia faba mRNA for phosphoenolpyruvate... 54 4e-04
208gb|AF268091.1|AF268091 Chloris gayana phosphoenolpyruvate carbox... 54 4e-04
209dbj|AB078720.3| Nicotiana sylvestris Nsppc3 gene for phosphoenol... 54 4e-04
210emb|AM235211.1| Lupinus luteus mRNA for phosphoenolpyruvate carb... 54 4e-04
211dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone... 54 4e-04
212dbj|AP006074.1| Lotus japonicus genomic DNA, chromosome 3, clone... 54 4e-04
213dbj|AB092821.1| Lotus japonicus LjPEPC2 mRNA for phosphoenolpyru... 54 4e-04
214dbj|AB092820.1| Lotus japonicus LjPEPC1 mRNA for phosphoenolpyru... 54 4e-04
215emb|AJ001028.1|KFPEPC458 Kalanchoe fedtschenkoi mRNA for phospho... 54 4e-04
216emb|AJ312673.1|ABA312673 Aloe vera partial mRNA for phosphoenolp... 52 0.001
217emb|AJ312630.1|ACO312630 Ananas comosus partial mRNA for phospho... 52 0.001
218emb|AJ252929.1|VPAJ2929 Vanilla pompona partial mRNA for phospho... 52 0.001
219emb|AJ231299.1|SBAJ1299 Symphyogyna brongniartii partial mRNA fo... 52 0.001
220emb|AJ231282.1|CCAJ1282 Calliergonella cuspidata partial mRNA fo... 52 0.001
221gb|AF530570.1| X Mokara cv. 'Yellow' phosphoenolpyruvate carboxy... 52 0.001
222gb|AF008939.1|AF008939 Gossypium hirsutum phosphoenolpyruvate ca... 52 0.001
223emb|AJ312655.1|TUS312655 Tillandsia usneoides partial mRNA for p... 52 0.001
224emb|X67053.1|STPPC S.tuberosum ppc mRNA for phosphoenolpyruvate ... 50 0.006
225emb|X95852.1|SSPPPC1 Sphagnum sp. HG-1998 mRNA for phosphoenolpy... 50 0.006
226emb|X95860.1|PAPPC1 Pereskia aculeata mRNA for phosphoenolpyruva... 50 0.006
227emb|X91635.1|MEPPCGENE M.exilis mRNA for phosphoenolpyruvate car... 50 0.006
228emb|X91634.1|VAPPCGENE V.aphylla mRNA for phosphoenolpyruvate ca... 50 0.006
229gb|DQ320103.1| Clusia hilariana phosphoenolpyruvate carboxylase ... 50 0.006
230emb|AJ312645.1|MCR312645 Mesembryanthemum crystallinum partial m... 50 0.006
231emb|AJ312628.1|ACO312628 Ananas comosus partial mRNA for phospho... 50 0.006
232emb|AJ400987.1|EST400987 Epidendrum stamfordianum partial mRNA f... 50 0.006
233emb|AJ252943.1|DFAJ2943 Dendrobium fimbriatum partial mRNA for p... 50 0.006
234emb|AJ252941.1|DMAJ2941 Dendrobium moschatum partial mRNA for ph... 50 0.006
235emb|AJ252940.1|DFAJ2940 Dendrobium farmeri partial mRNA for phos... 50 0.006
236emb|AJ252939.1|DFAJ2939 Dendrobium farmeri partial mRNA for phos... 50 0.006
237emb|AJ252936.1|DTAJ2936 Dendrobium thyrsifolium partial mRNA for... 50 0.006
238emb|AJ252935.1|DTAJ2935 Dendrobium thyrsifolium partial mRNA for... 50 0.006
239emb|AJ252934.1|DLAJ2934 Dendrobium loddigesii partial mRNA for p... 50 0.006
240emb|AJ252933.1|DLAJ2933 Dendrobium loddigesii partial mRNA for p... 50 0.006
241emb|AJ252918.1|KGAJ2918 Kalanchoe grandiflora partial mRNA for p... 50 0.006
242emb|AJ243416.1|LES243416 Lycopersicon esculentum mRNA for phosph... 50 0.006
243emb|AJ231281.1|BSAJ1281 Brachythecium salebrosum partial mRNA fo... 50 0.006
244gb|AF236126.1| Vitis vinifera PEP carboxylase (GPEPC) mRNA, part... 50 0.006
245gb|AY563044.1| Glycine max phosphoenolpyruvate carboxylase (PEPC... 48 0.023
246emb|AJ011844.1|STU011844 Solanum tuberosum ppc2 gene 48 0.023
247emb|X91140.1|STPPC2 S.tuberosum ppc2 gene 48 0.023
248emb|AJ312637.1|CUV312637 Clusia uvitana partial mRNA for phospho... 48 0.023
249emb|AJ313434.1|LES313434 Lycopersicon esculentum ppc2 gene for p... 48 0.023
250emb|AJ243417.1|LES243417 Lycopersicon esculentum mRNA for phosph... 48 0.023
251gb|AY950666.1| Alternanthera ficoidea phosphoenolpyruvate carbox... 46 0.089
252emb|AJ312651.1|KPI312651 Kalanchoe pinnata partial mRNA for phos... 46 0.089
253emb|AJ312648.1|KPI312648 Kalanchoe pinnata partial mRNA for phos... 46 0.089
254emb|AJ312636.1|CUV312636 Clusia uvitana partial mRNA for phospho... 46 0.089
255emb|AJ344057.1|KPI344057 Kalanchoe pinnata partial mRNA for phos... 46 0.089
256emb|AJ344054.1|KPI344054 Kalanchoe pinnata partial mRNA for phos... 46 0.089
257emb|AJ231292.1|MCAJ1292 Marchantia calcarata partial mRNA for ph... 46 0.089
258gb|AF459644.1| Lupinus albus phosphoenolpyruvate carboxylase (PE... 46 0.089
259gb|AY663386.1| Lupinus albus phosphoenolpyruvate carboxylase 2 m... 46 0.089
260emb|AJ312631.1|ACO312631 Ananas comosus partial mRNA for phospho... 44 0.35
261emb|AJ231279.1|BPAJ1279 Bartramia pomiformis partial mRNA for ph... 44 0.35
262gb|AF499727.1| Cucumis melo BAC clone PIT92-60K17, complete sequ... 42 1.4
263emb|Y17843.1|SWI17843 Selenicereus wittii mRNA for phosphoenolpy... 42 1.4
264emb|AJ312652.1|KPI312652 Kalanchoe pinnata partial mRNA for phos... 42 1.4
265emb|AJ312650.1|KPI312650 Kalanchoe pinnata partial mRNA for phos... 42 1.4
266emb|AJ312635.1|KDA312635 Kalanchoe daigremontiana partial mRNA f... 42 1.4
267emb|AJ344058.1|KPI344058 Kalanchoe pinnata partial mRNA for phos... 42 1.4
268emb|AJ344056.1|KPI344056 Kalanchoe pinnata partial mRNA for phos... 42 1.4
269emb|AJ252942.1|DFAJ2942 Dendrobium fimbriatum partial mRNA for p... 42 1.4
270dbj|AB239445.1| Phalacrocorax carbo CYP1A5 mRNA for cytochrome P... 42 1.4
271ref|NM_104209.2| Arabidopsis thaliana ATPPC1 (PHOSPHOENOLPYRUVAT... 40 5.5
272ref|NM_001036102.1| Arabidopsis thaliana ATPPC1 (PHOSPHOENOLPYRU... 40 5.5
273ref|NM_001036101.1| Arabidopsis thaliana ATPPC1 (PHOSPHOENOLPYRU... 40 5.5
274gb|CP000097.1| Synechococcus sp. CC9902, complete genome 40 5.5
275gb|AC114653.11| Mus musculus chromosome 5, clone RP24-158G19, co... 40 5.5
276gb|U41110.1| Caenorhabditis elegans cosmid ZK682, complete sequence 40 5.5
277ref|XM_847917.1| PREDICTED: Canis familiaris hypothetical protei... 40 5.5
278gb|AF159051.1| Picea abies phosphoenolpyruvate carboxylase (PEPC... 40 5.5
279gb|BT000647.1| Arabidopsis thaliana putative phosphoenolpyrovate... 40 5.5
280emb|X79090.1|PAPPCG P.abies (L.)Karst. ppc mRNA 40 5.5
281emb|AJ252931.1|VPAJ2931 Vanilla phalaenopsis partial mRNA for ph... 40 5.5
282emb|AJ231300.1|SNAJ1300 Scapania nemorea partial mRNA for phosph... 40 5.5
283emb|AJ231280.1|BRAJ1280 Bucegia romanica partial mRNA for phosph... 40 5.5
284emb|BX323549.16| Mouse DNA sequence from clone RP23-233O11 on ch... 40 5.5
285emb|BX908772.11| Zebrafish DNA sequence from clone DKEY-207H9 in... 40 5.5
286gb|AY057507.1| Arabidopsis thaliana At1g53310/F12M16_21 mRNA, co... 40 5.5
287gb|AC040914.5|AC040914 Homo sapiens chromosome 8, clone RP11-343... 40 5.5
288ref|NM_073001.3| Caenorhabditis elegans ZK682.5 (ZK682.5) mRNA, ... 40 5.5
289gb|AC115899.12| Mus musculus chromosome 5, clone RP24-445G9, com... 40 5.5
290gb|AC008007.7|AC008007 Genomic sequence for Arabidopsis thaliana... 40 5.5
291emb|AJ532901.1|ATH532901 Arabidopsis thaliana mRNA for phosphoen... 40 5.5
292emb|BX908765.9| Zebrafish DNA sequence from clone DKEY-102F14 in... 40 5.5
293gb|AF070225.1|AF070225 Heterodera glycines 14-3-3-like protein m... 40 5.5

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  214 bits (108), Expect = 2e-52
 Identities = 199/228 (87%), Gaps = 6/228 (2%)
 Strand = Plus / Plus

                                                                           
Query: 186     ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
               ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 8177152 ctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtcctc 8177211

                                                                           
Query: 246     caggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcct---t 302
               |||||| || ||  |||||||| ||  ||||||||| ||||||||||| ||||  |   |
Sbjct: 8177212 caggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggttgct 8177271

                                                                           
Query: 303     gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctct 362
               ||||  |||||||||||||| || |||||||   | | ||||||||||||| ||||| ||
Sbjct: 8177272 gtcgacgaactccttcgacaaggccggctgc---gacatcacctcgaagctagggtccct 8177328

                                                               
Query: 363     tatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
               |||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 8177329 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgta 8177376



to top

>gb|AF271995.1|AF271995 Oryza sativa phosphoenolpyruvate carboxylase mRNA, complete cds
          Length = 3307

 Score =  214 bits (108), Expect = 2e-52
 Identities = 199/228 (87%), Gaps = 6/228 (2%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 3067 ctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtcctc 3008

                                                                        
Query: 246  caggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcct---t 302
            |||||| || ||  |||||||| ||  ||||||||| ||||||||||| ||||  |   |
Sbjct: 3007 caggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggttgct 2948

                                                                        
Query: 303  gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctct 362
            ||||  |||||||||||||| || |||||||   | | ||||||||||||| ||||| ||
Sbjct: 2947 gtcgacgaactccttcgacaaggccggctgc---gacatcacctcgaagctagggtccct 2891

                                                            
Query: 363  tatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 2890 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgta 2843



to top

>dbj|AP004117.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1134_F06
          Length = 130968

 Score =  214 bits (108), Expect = 2e-52
 Identities = 199/228 (87%), Gaps = 6/228 (2%)
 Strand = Plus / Plus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 9298 ctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtcctc 9357

                                                                        
Query: 246  caggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcct---t 302
            |||||| || ||  |||||||| ||  ||||||||| ||||||||||| ||||  |   |
Sbjct: 9358 caggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggttgct 9417

                                                                        
Query: 303  gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctct 362
            ||||  |||||||||||||| || |||||||   | | ||||||||||||| ||||| ||
Sbjct: 9418 gtcgacgaactccttcgacaaggccggctgc---gacatcacctcgaagctagggtccct 9474

                                                            
Query: 363  tatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 9475 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgta 9522



to top

>dbj|AK065425.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013011N21, full
            insert sequence
          Length = 3809

 Score =  214 bits (108), Expect = 2e-52
 Identities = 199/228 (87%), Gaps = 6/228 (2%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 3077 ctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtcctc 3018

                                                                        
Query: 246  caggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcct---t 302
            |||||| || ||  |||||||| ||  ||||||||| ||||||||||| ||||  |   |
Sbjct: 3017 caggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggttgct 2958

                                                                        
Query: 303  gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctct 362
            ||||  |||||||||||||| || |||||||   | | ||||||||||||| ||||| ||
Sbjct: 2957 gtcgacgaactccttcgacaaggccggctgc---gacatcacctcgaagctagggtccct 2901

                                                            
Query: 363  tatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 2900 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgta 2853



to top

>dbj|AK065029.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001G17, full
            insert sequence
          Length = 3310

 Score =  214 bits (108), Expect = 2e-52
 Identities = 199/228 (87%), Gaps = 6/228 (2%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 3077 ctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtcctc 3018

                                                                        
Query: 246  caggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcct---t 302
            |||||| || ||  |||||||| ||  ||||||||| ||||||||||| ||||  |   |
Sbjct: 3017 caggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggttgct 2958

                                                                        
Query: 303  gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctct 362
            ||||  |||||||||||||| || |||||||   | | ||||||||||||| ||||| ||
Sbjct: 2957 gtcgacgaactccttcgacaaggccggctgc---gacatcacctcgaagctagggtccct 2901

                                                            
Query: 363  tatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 2900 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgta 2853



to top

>dbj|AK062201.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G07, full
            insert sequence
          Length = 1389

 Score =  214 bits (108), Expect = 2e-52
 Identities = 199/228 (87%), Gaps = 6/228 (2%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 1156 ctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtcctc 1097

                                                                        
Query: 246  caggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcct---t 302
            |||||| || ||  |||||||| ||  ||||||||| ||||||||||| ||||  |   |
Sbjct: 1096 caggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggttgct 1037

                                                                        
Query: 303  gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctct 362
            ||||  |||||||||||||| || |||||||   | | ||||||||||||| ||||| ||
Sbjct: 1036 gtcgacgaactccttcgacaaggccggctgc---gacatcacctcgaagctagggtccct 980

                                                            
Query: 363  tatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 979  tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgta 932



to top

>emb|AJ318341.1|SSP318341 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-1-3)
          Length = 743

 Score =  168 bits (85), Expect = 9e-39
 Identities = 197/233 (84%), Gaps = 6/233 (2%)
 Strand = Plus / Minus

                                                                       
Query: 182 tggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgt 241
           |||||||||| |||||||||||||| ||||| ||||||||||| |||||||| || ||||
Sbjct: 577 tggcctagccggtgttctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgt 518

                                                                       
Query: 242 cctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggct--- 298
           ||||||||||||| ||| ||||||||   |||||||| ||||||||||| || ||||   
Sbjct: 517 cctccaggcctggcgcatactcgctctgctggttcagctgcaccagctccgctggctgac 458

                                                                       
Query: 299 ccttgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggt 358
            || |||| |||||||||| |||||||||||||||   ||  |||||| |||||| ||||
Sbjct: 457 tctcgtcggtgaactccttggacaggggcggctgc---gggctcacctggaagctcgggt 401

                                                                
Query: 359 ctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           | | ||||||||||||||||||||| ||||| || ||||  || |||||||||
Sbjct: 400 cacgtatccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtag 348



to top

>gb|AY109352.1| Zea mays CL1793_1 mRNA sequence
          Length = 3349

 Score =  168 bits (85), Expect = 9e-39
 Identities = 197/233 (84%), Gaps = 6/233 (2%)
 Strand = Plus / Minus

                                                                        
Query: 182  tggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgt 241
            |||||||||| |||||||||||||| || || ||||||||||| ||||||||||||||||
Sbjct: 3084 tggcctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgt 3025

                                                                        
Query: 242  cctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggct--- 298
            ||||||||||||| ||  ||||||||   |||||||| ||||||||||| || ||||   
Sbjct: 3024 cctccaggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgac 2965

                                                                        
Query: 299  ccttgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggt 358
             || |||| |||||||||| |||||||||||||||   ||  |||||| |||||| ||||
Sbjct: 2964 tctcgtcggtgaactccttggacaggggcggctgc---gggctcacctggaagctcgggt 2908

                                                                 
Query: 359  ctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            | | ||||||||||||||||||||| ||||| || ||||  || |||||||||
Sbjct: 2907 cgcgtatccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtag 2855



to top

>dbj|AB012228.1| Zea mays mRNA for phosphoenolpyruvate carboxylase, complete cds
          Length = 3319

 Score =  168 bits (85), Expect = 9e-39
 Identities = 197/233 (84%), Gaps = 6/233 (2%)
 Strand = Plus / Minus

                                                                        
Query: 182  tggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgt 241
            |||||||||| |||||||||||||| || || ||||||||||| ||||||||||||||||
Sbjct: 3084 tggcctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgt 3025

                                                                        
Query: 242  cctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggct--- 298
            ||||||||||||| ||  ||||||||   |||||||| ||||||||||| || ||||   
Sbjct: 3024 cctccaggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgac 2965

                                                                        
Query: 299  ccttgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggt 358
             || |||| |||||||||| |||||||||||||||   ||  |||||| |||||| ||||
Sbjct: 2964 tctcgtcggtgaactccttggacaggggcggctgc---gggctcacctggaagctcgggt 2908

                                                                 
Query: 359  ctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            | | ||||||||||||||||||||| ||||| || ||||  || |||||||||
Sbjct: 2907 cgcgtatccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtag 2855



to top

>gb|BT017928.1| Zea mays clone EL01N0519G10.c mRNA sequence
          Length = 1453

 Score =  165 bits (83), Expect = 1e-37
 Identities = 180/211 (85%), Gaps = 6/211 (2%)
 Strand = Plus / Minus

                                                                        
Query: 182  tggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgt 241
            |||||||||| |||||||||||||| || || ||||||||||| ||||||||||||||||
Sbjct: 1182 tggcctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgt 1123

                                                                        
Query: 242  cctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggct--- 298
            ||||||||||||| ||  ||||||||   |||||||| ||||||||||| || ||||   
Sbjct: 1122 cctccaggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgac 1063

                                                                        
Query: 299  ccttgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggt 358
             || |||| |||||||||| |||||||||||||||   ||  |||||| |||||| ||||
Sbjct: 1062 tctcgtcggtgaactccttggacaggggcggctgc---gggctcacctggaagctcgggt 1006

                                           
Query: 359  ctcttatccgcttcagggtgtaggcttggca 389
            | | ||||||||||||||||||||| |||||
Sbjct: 1005 cgcgtatccgcttcagggtgtaggcctggca 975



to top

>emb|AJ318340.1|SSP318340 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-1-2)
          Length = 714

 Score =  161 bits (81), Expect = 2e-36
 Identities = 196/233 (84%), Gaps = 6/233 (2%)
 Strand = Plus / Minus

                                                                       
Query: 182 tggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgt 241
           |||||||||| |||| ||||||||| ||||| ||||||||||| |||||||| || ||||
Sbjct: 586 tggcctagccggtgtcctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgt 527

                                                                       
Query: 242 cctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggct--- 298
           ||||||||||||| ||| ||||||||   |||||||| ||||||||||| || ||||   
Sbjct: 526 cctccaggcctggcgcatactcgctctgctggttcagctgcaccagctctgctggctgac 467

                                                                       
Query: 299 ccttgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggt 358
            || |||| |||||||||| |||||||||||||||   ||  |||||| |||||| ||||
Sbjct: 466 tctcgtcggtgaactccttggacaggggcggctgc---gggctcacctggaagctcgggt 410

                                                                
Query: 359 ctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           | | ||||||||||||||||||||| ||||| || ||||  || |||||||||
Sbjct: 409 cacgtatccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtag 357



to top

>emb|AJ318339.1|SSP318339 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase (PPCS-1-1)
          Length = 755

 Score =  161 bits (81), Expect = 2e-36
 Identities = 196/233 (84%), Gaps = 6/233 (2%)
 Strand = Plus / Minus

                                                                       
Query: 182 tggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgt 241
           |||||||||| |||||||||||||| ||||| ||||||||||| |||||||| || ||||
Sbjct: 586 tggcctagccggtgttctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgt 527

                                                                       
Query: 242 cctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggct--- 298
           ||||||||||||| ||  ||||||||   |||||||| ||||||||||| || ||||   
Sbjct: 526 cctccaggcctggcgcgtactcgctctgctggttcagctgcaccagctccgctggctgac 467

                                                                       
Query: 299 ccttgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggt 358
            || |||| |||||||||| |||||||||||||||   ||  |||||| |||||| ||||
Sbjct: 466 tctcgtcggtgaactccttggacaggggcggctgc---gggctcacctggaagctcgggt 410

                                                                
Query: 359 ctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           | | ||||||||||||||||||||| ||||| || ||||  || |||||||||
Sbjct: 409 cacgtatccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtag 357



to top

>emb|X65137.1|SVPEPCGX S.vulgare pepC gene for PEP carboxylase
          Length = 7586

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/235 (83%), Gaps = 8/235 (3%)
 Strand = Plus / Minus

                                                                        
Query: 181  ctggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtg 240
            ||||||||||| || ||||||||||| ||||| ||||||||||| |||||||| || |||
Sbjct: 7254 ctggcctagccggtattctgcatgccggcagcgatgcccttcatggtcaggatcagtgtg 7195

                                                                        
Query: 241  tcctccaggcctggggcaaactcgctcccatggttcagttgcaccagct----cggcggg 296
            |||||||||||||| ||  ||||||||   |||||||| ||||||||||    |||| ||
Sbjct: 7194 tcctccaggcctggcgcgtactcgctctgctggttcagctgcaccagctccaccggctgg 7135

                                                                        
Query: 297  ctccttgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggg 356
            || || |||| |||||||||| |||||||||||||||   ||  |||||| |||||| ||
Sbjct: 7134 ct-ctcgtcggtgaactccttggacaggggcggctgc---gggctcacctggaagctcgg 7079

                                                                   
Query: 357  gtctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            ||| | ||||||||||||||||||||| ||||| || ||||  || |||||||||
Sbjct: 7078 gtcacgtatccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtag 7024



to top

>emb|X55664.1|SVPEPCA Sorghum vulgare mRNA for phosphoenolpyruvate carboxylase (PEPC)
          Length = 3128

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/235 (83%), Gaps = 8/235 (3%)
 Strand = Plus / Minus

                                                                        
Query: 181  ctggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtg 240
            ||||||||||| || ||||||||||| ||||| ||||||||||| |||||||| || |||
Sbjct: 2888 ctggcctagccggtattctgcatgccggcagcgatgcccttcatggtcaggatcagtgtg 2829

                                                                        
Query: 241  tcctccaggcctggggcaaactcgctcccatggttcagttgcaccagct----cggcggg 296
            |||||||||||||| ||  ||||||||   |||||||| ||||||||||    |||| ||
Sbjct: 2828 tcctccaggcctggcgcgtactcgctctgctggttcagctgcaccagctccaccggctgg 2769

                                                                        
Query: 297  ctccttgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggg 356
            || || |||| |||||||||| |||||||||||||||   ||  |||||| |||||| ||
Sbjct: 2768 ct-ctcgtcggtgaactccttggacaggggcggctgc---gggctcacctggaagctcgg 2713

                                                                   
Query: 357  gtctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            ||| | ||||||||||||||||||||| ||||| || ||||  || |||||||||
Sbjct: 2712 gtcacgtatccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtag 2658



to top

>emb|AJ318583.1|VZI318583 Vetiveria zizanioides partial 3' end mRNA for putative
           phosphoenolpyruvate carboxylase (pepc gene)
          Length = 515

 Score =  119 bits (60), Expect = 7e-24
 Identities = 190/232 (81%), Gaps = 6/232 (2%)
 Strand = Plus / Minus

                                                                       
Query: 183 ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
           ||||||||| |||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 324 ggcctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtc 265

                                                                       
Query: 243 ctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt 302
            ||||||||||| |   |||||||| |  |||| || |  |||||  |||||||||| ||
Sbjct: 264 ttccaggcctggcgggtactcgctcgccgggttgagctttaccagtccggcgggctcttt 205

                                                                       
Query: 303 ---gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtc 359
              ||||  ||||||||| ||||| ||||||||   ||||||||||| ||||||||||||
Sbjct: 204 ctcgtcggcgaactccttggacagcggcggctg---tggcgtcaccttgaagctggggtc 148

                                                               
Query: 360 tcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 147 ccttatccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 96



to top

>gb|AY251482.1| Echinochloa crus-galli phosphoenolpyruvate carboxylase (ppc) mRNA,
            complete cds
          Length = 2886

 Score =  119 bits (60), Expect = 7e-24
 Identities = 187/228 (82%), Gaps = 6/228 (2%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            |||||| |||||||||||||| || |||||||||||||| |||||||| || |||| |||
Sbjct: 2886 ctagccggtgttctgcatgccggcggcaatgcccttcatggtcaggatcagcgtgttctc 2827

                                                                        
Query: 246  caggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggct---cctt 302
            |||||| || ||  |||||||| || |||||||| |||||||||| || ||||    || 
Sbjct: 2826 caggcccggcgcgtactcgctctcagggttcagtcgcaccagctccgcaggctggctctc 2767

                                                                        
Query: 303  gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctct 362
            |||   ||||||||| ||||||| |||||||   ||  |||||| |||||||||||| | 
Sbjct: 2766 gtcaacgaactccttggacagggccggctgc---gggctcacctggaagctggggtcgcg 2710

                                                            
Query: 363  tatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
             ||||||||||||||||| || ||||| || |||| ||| ||||||||
Sbjct: 2709 aatccgcttcagggtgtacgcctggcatacgttcagggtggtgatgta 2662



to top

>gb|AF271162.1| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 2 mRNA,
            complete cds
          Length = 3212

 Score =  117 bits (59), Expect = 3e-23
 Identities = 77/83 (92%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||
Sbjct: 2961 gtgttctgcatgccagcagcaatacccttcatagtcaagatgagggtgtcctccagtcct 2902

                                   
Query: 253  ggggcaaactcgctcccatggtt 275
            |||||| |||| |||||| ||||
Sbjct: 2901 ggggcatactcactcccagggtt 2879



to top

>emb|AJ293347.1|SVE293347 Sorghum verticilliflorum partial mRNA for putative C4
           phosphoenolpyruvate carboyxlase (PEPC gene)
          Length = 504

 Score =  111 bits (56), Expect = 2e-21
 Identities = 189/232 (81%), Gaps = 6/232 (2%)
 Strand = Plus / Minus

                                                                       
Query: 183 ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
           ||||||||| |||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 324 ggcctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagagtgtc 265

                                                                       
Query: 243 ctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt 302
            ||||| || || |   |||||||| |  ||||||| | ||||||  |||||||||  ||
Sbjct: 264 ttccagccccggtgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgtt 205

                                                                       
Query: 303 ---gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtc 359
              ||||  ||||||||| ||||| |||||||||   |||||||||| ||||||||||||
Sbjct: 204 ctcgtcggcgaactccttggacagcggcggctgc---ggcgtcaccttgaagctggggtc 148

                                                               
Query: 360 tcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 147 ccttatccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 96



to top

>emb|AJ318582.1|EAU318582 Eulalia aurea partial 3' end mRNA for putative phosphoenolpyruvate
           carboxylase, (pepc gene)
          Length = 506

 Score =  103 bits (52), Expect = 4e-19
 Identities = 188/232 (81%), Gaps = 6/232 (2%)
 Strand = Plus / Minus

                                                                       
Query: 183 ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
           ||||||||| |||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 324 ggcctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtc 265

                                                                       
Query: 243 ctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt 302
            ||||| ||||| |   |||||||| |  ||||||| | ||||||  |||||||||  ||
Sbjct: 264 ttccagccctggcgggtactcgctcgccgggttcagcttcaccaggccggcgggcttgtt 205

                                                                       
Query: 303 ---gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtc 359
              ||||  ||||||||| ||||| |||||||||   |||||||||| ||||||||||||
Sbjct: 204 ctcgtcggcgaactccttggacagcggcggctgc---ggcgtcaccttgaagctggggtc 148

                                                               
Query: 360 tcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            || |||| |||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 147 cctaatcctcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 96



to top

>gb|AF271161.2| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 1 mRNA,
            complete cds
          Length = 3368

 Score =  101 bits (51), Expect = 2e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||||||||||||||||||||| |||||||| |||| |||||| ||||||||||| |||
Sbjct: 2965 gtgttctgcatgccagcagcaatacccttcatggtcaagatgagagtgtcctccagtcct 2906

                                   
Query: 253  ggggcaaactcgctcccatggtt 275
            |||||| |||| |||||| ||||
Sbjct: 2905 ggggcatactcactcccagggtt 2883



to top

>emb|X15239.1|ZMPEPC1G Maize PEPC1 gene for phosphoenolpyruvate carboxylase (EC 4.1.1.31)
          Length = 6151

 Score =  101 bits (51), Expect = 2e-18
 Identities = 187/231 (80%), Gaps = 6/231 (2%)
 Strand = Plus / Minus

                                                                        
Query: 184  gcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcc 243
            |||||||| |||||||||||||| || || ||||||||||| || |||||||| ||||| 
Sbjct: 5676 gcctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtct 5617

                                                                        
Query: 244  tccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt- 302
            |||||||| || |   |||||||| |  ||||||| |  |||||  |||||||||  || 
Sbjct: 5616 tccaggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttc 5557

                                                                        
Query: 303  --gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtct 360
              ||||  ||||||||| ||||| ||||||||    |||||||||| |||| ||||||| 
Sbjct: 5556 tcgtcggcgaactccttggacagcggcggctgg---ggcgtcaccttgaagttggggtcc 5500

                                                               
Query: 361  cttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 5499 cttatccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 5449



to top

>emb|X15238.1|ZMPEPC1 Maize mRNA for phosphoenolpyruvate carboxylase (EC 4.1.1.31)
          Length = 3265

 Score =  101 bits (51), Expect = 2e-18
 Identities = 187/231 (80%), Gaps = 6/231 (2%)
 Strand = Plus / Minus

                                                                        
Query: 184  gcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcc 243
            |||||||| |||||||||||||| || || ||||||||||| || |||||||| ||||| 
Sbjct: 2995 gcctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtct 2936

                                                                        
Query: 244  tccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt- 302
            |||||||| || |   |||||||| |  ||||||| |  |||||  |||||||||  || 
Sbjct: 2935 tccaggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttc 2876

                                                                        
Query: 303  --gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtct 360
              ||||  ||||||||| ||||| ||||||||    |||||||||| |||| ||||||| 
Sbjct: 2875 tcgtcggcgaactccttggacagcggcggctgg---ggcgtcaccttgaagttggggtcc 2819

                                                               
Query: 361  cttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 2818 cttatccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 2768



to top

>emb|X15642.1|ZMPEP Z.mays gene for phosphoenolpyruvate carboxylase (EC 4.1.1.31)
          Length = 6781

 Score =  101 bits (51), Expect = 2e-18
 Identities = 187/231 (80%), Gaps = 6/231 (2%)
 Strand = Plus / Minus

                                                                        
Query: 184  gcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcc 243
            |||||||| |||||||||||||| || || ||||||||||| || |||||||| ||||| 
Sbjct: 6320 gcctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtct 6261

                                                                        
Query: 244  tccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt- 302
            |||||||| || |   |||||||| |  ||||||| |  |||||  |||||||||  || 
Sbjct: 6260 tccaggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttc 6201

                                                                        
Query: 303  --gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtct 360
              ||||  ||||||||| ||||| ||||||||    |||||||||| |||| ||||||| 
Sbjct: 6200 tcgtcggcgaactccttggacagcggcggctgg---ggcgtcaccttgaagttggggtcc 6144

                                                               
Query: 361  cttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 6143 cttatccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 6093



to top

>gb|AY103747.1| Zea mays PCO070206 mRNA sequence
          Length = 3289

 Score =  101 bits (51), Expect = 2e-18
 Identities = 187/231 (80%), Gaps = 6/231 (2%)
 Strand = Plus / Minus

                                                                        
Query: 184  gcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcc 243
            |||||||| |||||||||||||| || || ||||||||||| || |||||||| ||||| 
Sbjct: 2995 gcctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtct 2936

                                                                        
Query: 244  tccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt- 302
            |||||||| || |   |||||||| |  ||||||| |  |||||  |||||||||  || 
Sbjct: 2935 tccaggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttc 2876

                                                                        
Query: 303  --gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtct 360
              ||||  ||||||||| ||||| ||||||||    |||||||||| |||| ||||||| 
Sbjct: 2875 tcgtcggcgaactccttggacagcggcggctgg---ggcgtcaccttgaagttggggtcc 2819

                                                               
Query: 361  cttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 2818 cttatccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 2768



to top

>emb|AJ536629.1|ZMA536629 Zea mays mRNA for phosphoenolpyruvate carboxylase (ppc1 gene), clone
            pM500
          Length = 2913

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 185/229 (80%), Gaps = 6/229 (2%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            |||||| |||||||||||||| || || ||||||||||| || |||||||| ||||| ||
Sbjct: 2913 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 2854

                                                                        
Query: 246  caggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt--- 302
            |||||| || |   |||||||| |  ||||||| |  |||||  |||||||||  ||   
Sbjct: 2853 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2794

                                                                        
Query: 303  gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctct 362
            ||||  ||||||||| ||||| ||||||||    |||||||||| |||| ||||||| ||
Sbjct: 2793 gtcggcgaactccttggacagcggcggctgg---ggcgtcaccttgaagttggggtccct 2737

                                                             
Query: 363  tatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 2736 tatccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 2688



to top

>gb|AF271163.1| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 3 mRNA,
            complete cds
          Length = 3218

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||| ||||||||||||||||| |||||||| |||| |||||| ||||||||||| |||
Sbjct: 2956 gtgttttgcatgccagcagcaatacccttcatggtcaagatgagagtgtcctccagtcct 2897

                                   
Query: 253  ggggcaaactcgctcccatggtt 275
            |||||| |||| |||||| ||||
Sbjct: 2896 ggggcatactcactcccagggtt 2874



to top

>ref|NM_188892.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3158

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 187  tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
            ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 2949 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2890

              
Query: 247  ag 248
            ||
Sbjct: 2889 ag 2888



to top

>ref|XM_507204.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1484_G09.129-1
            mRNA
          Length = 3539

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 187  tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
            ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 3214 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 3155

              
Query: 247  ag 248
            ||
Sbjct: 3154 ag 3153



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                            
Query: 187      tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
                ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 16957794 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 16957853

                  
Query: 247      ag 248
                ||
Sbjct: 16957854 ag 16957855



to top

>dbj|AP003913.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1484_G09
          Length = 124695

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                          
Query: 187    tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
              ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 104805 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 104864

                
Query: 247    ag 248
              ||
Sbjct: 104865 ag 104866



to top

>dbj|AK073703.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033055B18, full
            insert sequence
          Length = 3538

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 187  tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
            ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 3213 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 3154

              
Query: 247  ag 248
            ||
Sbjct: 3153 ag 3152



to top

>dbj|AK070742.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061C12, full
            insert sequence
          Length = 4317

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 187  tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
            ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 4115 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 4056

              
Query: 247  ag 248
            ||
Sbjct: 4055 ag 4054



to top

>dbj|AK067572.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108G24, full
            insert sequence
          Length = 3158

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 187  tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
            ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 2949 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2890

              
Query: 247  ag 248
            ||
Sbjct: 2889 ag 2888



to top

>dbj|AK061683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A07, full
            insert sequence
          Length = 1704

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 187  tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
            ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 1505 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 1446

              
Query: 247  ag 248
            ||
Sbjct: 1445 ag 1444



to top

>gb|AY187619.1| Oryza sativa (indica cultivar-group) phosphoenolpyruvate carboxylase
            (PEPC) mRNA, complete cds
          Length = 2981

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 187  tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
            ||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 2955 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2896

              
Query: 247  ag 248
            ||
Sbjct: 2895 ag 2894



to top

>gb|AY491400.1| Setaria italica C3 phosphoenolpyruvate carboxylase (ppc1) mRNA,
            complete cds
          Length = 2886

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 186/229 (81%), Gaps = 8/229 (3%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            |||||| ||||||||||| || || || || |||||||| |||||||| || ||||||||
Sbjct: 2886 ctagccggtgttctgcatcccggcggcgatacccttcatggtcaggatcagcgtgtcctc 2827

                                                                        
Query: 246  caggcctggggcaaactcgctcccatggttcagttgcaccagct----cggcgggctcct 301
            |||||| || ||  |||||||| |  ||||||| ||||||||||    |||| |||| ||
Sbjct: 2826 caggcccggcgcgtactcgctctcggggttcagctgcaccagctgcgccggctggct-ct 2768

                                                                        
Query: 302  tgtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctc 361
             |||| |||||||||| ||||| | ||||||  | ||| |||||| |||||  ||||| |
Sbjct: 2767 cgtcggtgaactccttggacagagccggctg--ggggc-tcacctggaagccagggtcac 2711

                                                             
Query: 362  ttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
              |||||||||||||||||||| ||||| || |||| ||| ||||||||
Sbjct: 2710 gaatccgcttcagggtgtaggcctggcagacgttcagggtggtgatgta 2662



to top

>emb|X63756.1|SVPEPCAA S.vulgare PEPC gene
          Length = 7071

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 89/103 (86%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 309  gaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctcttatccg 368
            ||||||||| ||||| |||||||||   |||||||||| |||||||||||| ||||||||
Sbjct: 6428 gaactccttggacagcggcggctgc---ggcgtcaccttgaagctggggtcccttatccg 6372

                                                       
Query: 369  cttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 6371 cttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 6329



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 183  ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
            ||||||||| |||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 6554 ggcctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtc 6495

                  
Query: 243  ctccag 248
             |||||
Sbjct: 6494 ttccag 6489



to top

>emb|X17379.1|SVPEPC Sorghum vulgare mRNA for phosphoenolpyruvate involved in C4
            photosynthesis (EC 4.1.1.31)
          Length = 3192

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 89/103 (86%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 309  gaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctcttatccg 368
            ||||||||| ||||| |||||||||   |||||||||| |||||||||||| ||||||||
Sbjct: 2791 gaactccttggacagcggcggctgc---ggcgtcaccttgaagctggggtcccttatccg 2735

                                                       
Query: 369  cttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 2734 cttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 2692



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 183  ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
            ||||||||| |||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 2917 ggcctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtc 2858

                  
Query: 243  ctccag 248
             |||||
Sbjct: 2857 ttccag 2852



to top

>gb|M86661.1|SCFSCPEPCD Saccharum hybrid cultivar H32-8560 phosphoenolpyruvate carboxylase
            (SCPEPCD1) gene, complete cds
          Length = 8638

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                        
Query: 188  agcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||| ||||||||||| || ||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 8111 agccggtgttctgcattccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 8052

                                
Query: 248  ggcctggggcaaactcgctc 267
            | || |||||  ||||||||
Sbjct: 8051 gtcccggggcgtactcgctc 8032



to top

>emb|AJ318338.1|SSP318338 Saccharum spontaneum mRNA for putative C4 phosphoenolpyruvate
            carboxylase (pepc gene), (C4 PPCSs-1)
          Length = 3015

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 165/204 (80%), Gaps = 6/204 (2%)
 Strand = Plus / Minus

                                                                        
Query: 183  ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
            ||||||||| |||||||||||||| || || || || ||||| || |||||||| |||||
Sbjct: 2889 ggcctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtc 2830

                                                                        
Query: 243  ctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt 302
             ||||| || || |   | |||||| |  ||||||| | ||||||  |||||||||  ||
Sbjct: 2829 ttccagcccgggcgggtattcgctcgccgggttcagcttcaccagtccggcgggcttgtt 2770

                                                                        
Query: 303  ---gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtc 359
               ||||  ||||||||| ||||| |||||||||   |||||||||| ||||||||||||
Sbjct: 2769 ctcgtcggcgaactccttggacagtggcggctgc---ggcgtcaccttgaagctggggtc 2713

                                    
Query: 360  tcttatccgcttcagggtgtaggc 383
             |||||||||||||| ||||||||
Sbjct: 2712 ccttatccgcttcagcgtgtaggc 2689



to top

>emb|AJ293348.1|CLA293348 Coix lacryma-jobi partial mRNA for putative C4 phosphoenolpyruvate
           carboxylase (PEPC gene)
          Length = 506

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 165/204 (80%), Gaps = 6/204 (2%)
 Strand = Plus / Minus

                                                                       
Query: 183 ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
           ||||||||| |||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 324 ggcctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtc 265

                                                                       
Query: 243 ctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt 302
            ||||| ||||| |   | |||||| |  ||||||||| |||||| ||||||||||  ||
Sbjct: 264 ttccagccctggcgggtagtcgctcgccgggttcagtttcaccagttcggcgggcttgtt 205

                                                                       
Query: 303 ---gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtc 359
              ||||  ||||||||| ||||| |||||| ||   ||||||  || |||| |||||||
Sbjct: 204 cgcgtcggcgaactccttggacagcggcggcagc---ggcgtcgtcttgaagttggggtc 148

                                   
Query: 360 tcttatccgcttcagggtgtaggc 383
            |||||||||||||| ||||||||
Sbjct: 147 ccttatccgcttcagcgtgtaggc 124



to top

>emb|AJ252923.1|KSAJ2923 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1116

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||||||||| |||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 1103 tgcatgccagcggcaatgcccttcatggtcaggatgagggtgtcctccagaccaggagca 1044

                    
Query: 259  aactcgct 266
             |||||||
Sbjct: 1043 tactcgct 1036



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ231303.1|KSAJ1303 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1116

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||||||||| |||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 1103 tgcatgccagcggcaatgcccttcatggtcaggatgagggtgtcctccagaccaggagca 1044

                    
Query: 259  aactcgct 266
             |||||||
Sbjct: 1043 tactcgct 1036



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>ref|NM_191306.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2901

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||||||||| |||||||| ||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 2894 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctcgaggcct 2835

               
Query: 253  ggg 255
            |||
Sbjct: 2834 ggg 2832



to top

>emb|X03613.1|ZMPEPCR Maize mRNA for phosphoenolpyruvate carboxylase (PEPCase EC 4.1.1.31)
          Length = 3028

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 185/231 (80%), Gaps = 6/231 (2%)
 Strand = Plus / Minus

                                                                        
Query: 184  gcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcc 243
            |||||||| |||||||||||||| ||    ||||||||||| || |||||||| ||||| 
Sbjct: 2811 gcctagccagtgttctgcatgccggcgcggatgcccttcatggtgaggatgagcgtgtct 2752

                                                                        
Query: 244  tccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt- 302
            |||||||| || |   |||||||| |  ||||||| |  |||||  |||||||||  || 
Sbjct: 2751 tccaggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttc 2692

                                                                        
Query: 303  --gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtct 360
              ||||  ||||||||| ||||| ||||||||    |||||||||| |||| ||||||| 
Sbjct: 2691 tcgtcggcgaactccttggacagcggcggctgg---ggcgtcaccttgaagttggggtcc 2635

                                                               
Query: 361  cttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| |||||||| ||| | || |||| ||| |||||||||
Sbjct: 2634 cttatccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtag 2584



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                           
Query: 193     gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
               ||||||||||  || ||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 8638305 gtgttctgcaaccctgcagcaatgcccttcatggtcaggatgagggtgtcctccagccct 8638364

                                                          
Query: 253     ggggcaaactcgctcccatggttcagttgcaccagctcggcgg 295
               || ||  ||||||| ||  ||||||| | ||| ||||| ||||
Sbjct: 8638365 ggcgcgtactcgctacccgggttcagcttcacaagctccgcgg 8638407



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                               
Query: 364     atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
               ||||| ||||| |||||||||||||| ||||||| ||| || ||||||
Sbjct: 8638479 atccgtttcagcgtgtaggcttggcagacattcagggtggttatgtag 8638526



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                            
Query: 193      gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
                ||||||||||| |||||||| ||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 31852803 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctcgaggcct 31852862

                   
Query: 253      ggg 255
                |||
Sbjct: 31852863 ggg 31852865



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                           
Query: 188     agcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
               |||| |||||||||||||| || || ||||||||||| || |||||||| ||||||||||
Sbjct: 5908267 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 5908208

                
Query: 248     g 248
               |
Sbjct: 5908207 g 5908207



to top

>dbj|AP003409.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1131G08
          Length = 158241

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                         
Query: 193   gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
             ||||||||||| |||||||| ||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 38881 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctcgaggcct 38940

                
Query: 253   ggg 255
             |||
Sbjct: 38941 ggg 38943



to top

>dbj|AP005802.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0057D11
          Length = 190790

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                         
Query: 193   gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
             ||||||||||  || ||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 68101 gtgttctgcaaccctgcagcaatgcccttcatggtcaggatgagggtgtcctccagccct 68160

                                                        
Query: 253   ggggcaaactcgctcccatggttcagttgcaccagctcggcgg 295
             || ||  ||||||| ||  ||||||| | ||| ||||| ||||
Sbjct: 68161 ggcgcgtactcgctacccgggttcagcttcacaagctccgcgg 68203



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 364   atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
             ||||| ||||| |||||||||||||| ||||||| ||| || ||||||
Sbjct: 68275 atccgtttcagcgtgtaggcttggcagacattcagggtggttatgtag 68322



to top

>dbj|AK101274.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033033B07, full
            insert sequence
          Length = 3056

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||||||||| |||||||| ||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 2845 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctcgaggcct 2786

               
Query: 253  ggg 255
            |||
Sbjct: 2785 ggg 2783



to top

>dbj|AK070480.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023049F03, full
            insert sequence
          Length = 2668

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||||||||| |||||||| ||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 2456 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctcgaggcct 2397

               
Query: 253  ggg 255
            |||
Sbjct: 2396 ggg 2394



to top

>gb|AY111910.1| Zea mays CL16446_1 mRNA sequence
          Length = 607

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Plus

                                                                       
Query: 188 agcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
           |||| ||||||||||| || ||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 141 agcccgtgttctgcatcccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 200

                              
Query: 248 ggcctggggcaaactcgct 266
           | || |||||  |||||||
Sbjct: 201 gccccggggcgtactcgct 219



to top

>gb|AY107882.1| Zea mays PCO089178 mRNA sequence
          Length = 1373

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                        
Query: 188  agcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||| ||||||||||| || ||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 1242 agccggtgttctgcatcccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 1183

                               
Query: 248  ggcctggggcaaactcgct 266
            | || |||||  |||||||
Sbjct: 1182 gccccggggcgtactcgct 1164



to top

>dbj|AB055075.1| Oryza sativa (japonica cultivar-group) mRNA for phosphoenolpyruvate
           carboxylase, partial cds, clone:OsppcAUC-2
          Length = 991

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 193 gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
           ||||||||||| |||||||| ||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 791 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctcgaggcct 732

              
Query: 253 ggg 255
           |||
Sbjct: 731 ggg 729



to top

>emb|Z68125.1|AHC4PHPEC A.hypochondriacus mRNA for C4 photosynthetic phosphoenolpyruvate
            carboxylase
          Length = 3106

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                       
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcc 251
            ||||||||||||||||||||||| |||||||| |||| ||| ||||||||||| |||||
Sbjct: 2966 gtgttctgcatgccagcagcaatacccttcatggtcaagataagggtgtcctcgaggcc 2908



to top

>emb|AJ300742.1|PAM300742 Phalaenopsis amabilis partial ppc gene for phosphoenolpyruvate
            carboxylase
          Length = 2898

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            |||||| ||||||||||||||||||||||| || ||||| | |||||||||||| |||||
Sbjct: 2898 ctagccggtgttctgcatgccagcagcaatacctttcatggccaggatgagggtatcctc 2839

               
Query: 246  cag 248
            |||
Sbjct: 2838 cag 2836



to top

>gb|AF288382.1|AF288382 Phaseolus vulgaris phosphoenolpyruvate carboxylase mRNA, complete cds
          Length = 3289

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 2974 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagggtgtcttcca 2920



to top

>gb|L49175.1|AMHCPPC Amaranthus hypochondriacus C4 photosynthetic phosphoenolpyruvate
            carboxylase mRNA, complete cds
          Length = 3106

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                       
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcc 251
            ||||||||||||||||||||||| |||||||| |||| ||| ||||||||||| |||||
Sbjct: 2966 gtgttctgcatgccagcagcaatacccttcatggtcaagataagggtgtcctcgaggcc 2908



to top

>dbj|AB097088.1| Glycine max GmPEPC7 gene for phosphoenolpyruvate carboxylase,
            complete cds
          Length = 8079

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                              
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
            ||||||||||||||||||||||| ||||||||||| || |||||||||||
Sbjct: 7261 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagggtgtc 7212



to top

>dbj|AB008540.1| Glycine max mRNA for phosphoenolpyruvate carboxylase, complete cds,
            clone:GmPEPC7
          Length = 3536

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                              
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
            ||||||||||||||||||||||| ||||||||||| || |||||||||||
Sbjct: 3100 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagggtgtc 3051



to top

>emb|X59925.1|SVPEPCG S.vulgare PEPC gene for phosphoenolpyruvate carboxylase
          Length = 6018

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                        
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgctcccatgg 273
            ||||||||||| ||||| ||||||||||||||||| || || ||| ||||||| ||| ||
Sbjct: 5670 atgcccttcatggtcagaatgagggtgtcctccagccccggtgcatactcgctgccaggg 5611

                             
Query: 274  ttcagttgcaccagctc 290
            ||||| | |||||||||
Sbjct: 5610 ttcagcttcaccagctc 5594



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||||||||||||||| ||||| || |||| ||| ||||||||
Sbjct: 5517 atccgcttcagggtgtaggcctggcagacgttcagggtggtgatgta 5471



to top

>emb|AJ312665.1|SAP312665 Solenangis aphylla partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 3
          Length = 705

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 208 gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
           ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 704 gcagcaatgcccttcatggtcaggatgagggtgtcctccag 664



to top

>emb|AJ312632.1|KDA312632 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 1
          Length = 1092

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 1085 atgcccttcatggtcaggatgagggtgtcctccaggccaggggca 1041



to top

>gb|AY135709.1| Saccharum hybrid cultivar putative C4 phosphoenolpyruvate carboxylase
            mRNA, complete cds
          Length = 3205

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 163/204 (79%), Gaps = 6/204 (2%)
 Strand = Plus / Minus

                                                                        
Query: 183  ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
            ||||||||| |||||||||||||| || || || || ||||| || |||||||| |||||
Sbjct: 2984 ggcctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtc 2925

                                                                        
Query: 243  ctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt 302
             ||||| || || |   |||||||| |  ||||||| | ||||||  |||||||||  ||
Sbjct: 2924 ttccagcccgggcgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgtt 2865

                                                                        
Query: 303  ---gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtc 359
               ||||  ||||||||| ||||  |||||||||   |||||||||| |||||| || ||
Sbjct: 2864 ctcgtcggcgaactccttggacaacggcggctgc---ggcgtcaccttgaagctcggatc 2808

                                    
Query: 360  tcttatccgcttcagggtgtaggc 383
             |||||||||||||| ||||||||
Sbjct: 2807 ccttatccgcttcagcgtgtaggc 2784



to top

>emb|X87820.1|KBRNAPPC3 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase  (Kb3)
          Length = 1092

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                
Query: 207  agcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            |||||| ||||||||||| ||||| |||||||||||||||||||| ||||||
Sbjct: 1092 agcagcgatgcccttcattgtcagaatgagggtgtcctccaggccaggggca 1041



to top

>emb|AJ293346.1|SOF293346 Saccharum officinarum mRNA for putative C4 phosphoenolpyruvate
            carboxylase (PEPC gene)
          Length = 3067

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 163/204 (79%), Gaps = 6/204 (2%)
 Strand = Plus / Minus

                                                                        
Query: 183  ggcctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
            ||||||||| |||||||||||||| || || || || ||||| || |||||||| |||||
Sbjct: 2889 ggcctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtc 2830

                                                                        
Query: 243  ctccaggcctggggcaaactcgctcccatggttcagttgcaccagctcggcgggctcctt 302
             ||||| || || |   |||||||| |  ||||||| | ||||||  |||||||||  ||
Sbjct: 2829 ttccagcccgggcgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgtt 2770

                                                                        
Query: 303  ---gtcgctgaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtc 359
               ||||  ||||||||| ||||| |||||||||   |||||||||| |||||  || ||
Sbjct: 2769 ctcgtcggcgaactccttggacagcggcggctgc---ggcgtcaccttgaagcacggatc 2713

                                    
Query: 360  tcttatccgcttcagggtgtaggc 383
             |||||||||||||| ||||||||
Sbjct: 2712 ccttatccgcttcagcgtgtaggc 2689



to top

>emb|AJ252946.1|KGAJ2946 Kalanchoe gracilipes partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1116

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                        
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||||||||| ||  |||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 1103 tgcatgccagcggcgttgcccttcatggtcaggatgagggtgtcctccagaccaggagca 1044

                    
Query: 259  aactcgct 266
             |||||||
Sbjct: 1043 tactcgct 1036



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ231288.1|KGAJ1288 Kalanchoe gracilipes partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1116

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                        
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||||||||| ||  |||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 1103 tgcatgccagcggcgttgcccttcatggtcaggatgagggtgtcctccagaccaggagca 1044

                    
Query: 259  aactcgct 266
             |||||||
Sbjct: 1043 tactcgct 1036



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>gb|AF495586.1| Setaria italica putative C4 phosphoenolpyruvate carboxylase (ppc)
            mRNA, complete cds
          Length = 3214

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                        
Query: 185  cctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcct 244
            ||||||| |||||||||||||| || || ||||||||||| || |||||||| |||||||
Sbjct: 2959 cctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcct 2900

                
Query: 245  ccag 248
            ||||
Sbjct: 2899 ccag 2896



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 65/75 (86%), Gaps = 3/75 (4%)
 Strand = Plus / Minus

                                                                        
Query: 309  gaactccttcgacaggggcggctgctgtggcgtcacctcgaagctggggtctcttatccg 368
            ||||||||| ||||| |||||||||   |||||||||| |||| | ||||| ||||||| 
Sbjct: 2832 gaactccttggacagcggcggctgc---ggcgtcaccttgaagttcgggtcccttatcct 2776

                           
Query: 369  cttcagggtgtaggc 383
            |||||||||||||||
Sbjct: 2775 cttcagggtgtaggc 2761



to top

>gb|AF494192.1| Flaveria pubescens phosphoenolpyruvate carboxylase FPUB966 (ppcA)
            mRNA, complete cds
          Length = 3263

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| || ||||| |||| |||||||||||||||||
Sbjct: 3035 gtgttctgcattccagcagcaatccctttcatggtcaagatgagggtgtcctcca 2981



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||| ||| ||||| || |||||||| ||||| ||||||||||||||
Sbjct: 2858 atcctctttagggtataagcttggcatacatttaaggttgtgatgta 2812



to top

>gb|AF494191.1| Flaveria brownii phosphoenolpyruvate carboxylase FB966 (ppcA) mRNA,
            complete cds
          Length = 3153

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| || ||||| |||| |||||||||||||||||
Sbjct: 2940 gtgttctgcatcccagcagcaatccctttcatggtcaagatgagggtgtcctcca 2886



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||| ||| ||||| || |||||||| ||||| ||||||||||||||
Sbjct: 2763 atcctctttagggtataagcttggcatacatttaaggttgtgatgta 2717



to top

>emb|Z71974.1|FTPPCB F.trinervia ppcB gene (partial)
          Length = 814

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 193 gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
           ||||||||||| ||||||||||| |||||||| |||| |||||| ||||||||||
Sbjct: 196 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 142



to top

>emb|Z71973.1|FPPPCB F.pringlei ppcB gene (partial)
          Length = 714

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 193 gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
           ||||||||||| ||||||||||| |||||||| |||| |||||| ||||||||||
Sbjct: 196 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 142



to top

>emb|X87821.1|KBRNAPCC4 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase  (Kb4)
          Length = 1092

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||| ||||||||||| ||||| |||||||||||||||||||| ||||||
Sbjct: 1091 gcagcgatgcccttcattgtcagaatgagggtgtcctccaggccaggggca 1041



to top

>emb|AJ312678.1|KFE312678 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 1
          Length = 723

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 208 gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
           ||||| ||||||||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 722 gcagcgatgcccttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 664



to top

>emb|AJ300741.1|PEQ300741 Phalaenopsis equestris partial ppc gene for phosphoenolpyruvate
            carboxylase
          Length = 2898

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            |||||| |||||||||| |||||||||||| || ||||| | |||||||||||| |||||
Sbjct: 2898 ctagccggtgttctgcaggccagcagcaatacctttcatggccaggatgagggtatcctc 2839

               
Query: 246  cag 248
            |||
Sbjct: 2838 cag 2836



to top

>emb|AJ286750.1|SRO286750 Sesbania rostrata mRNA for phosphoenolpyruvate carboxylase (pepc
            gene)
          Length = 3344

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||| ||||| ||||||||||| || ||||||||||| ||||
Sbjct: 3012 gtgttctgcatgccagctgcaatacccttcatagtgagaatgagggtgtcttcca 2958



to top

>emb|AJ252917.1|KTAJ2917 Kalanchoe tomentosa partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1095

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| |||||||||||||||||||| |||||||| |||||||||||
Sbjct: 932 atccgtttcagggtgtaggcttggcacacattcaatgttgtgatgta 886



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 217  cccttcatagtcaggatgagggtgtcctcca 247
            |||||||| ||||| ||||||||||||||||
Sbjct: 1085 cccttcatggtcagtatgagggtgtcctcca 1055



to top

>emb|AJ252916.1|KTAJ2916 Kalanchoe tomentosa partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1095

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| |||||||||||||||||||| |||||||| |||||||||||
Sbjct: 932 atccgtttcagggtgtaggcttggcacacattcaatgttgtgatgta 886



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 217  cccttcatagtcaggatgagggtgtcctcca 247
            |||||||| ||||| ||||||||||||||||
Sbjct: 1085 cccttcatggtcagtatgagggtgtcctcca 1055



to top

>emb|AJ231290.1|LJAJ1290 Leucobryum juniperoideum partial mRNA for phosphoenolpyruvate
            carboxylase, clone pLU24.2
          Length = 1119

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            |||||||||||||| ||||||||||| || |||||||||||||||||
Sbjct: 1106 tgcatgccagcagctatgcccttcattgtaaggatgagggtgtcctc 1060



to top

>gb|AF248079.1|AF248079 Flaveria trinervia phosphoenolpyruvate carboxylase (ppcB) mRNA,
            complete cds
          Length = 3266

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| |||||||| |||| |||||| ||||||||||
Sbjct: 2991 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 2937



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 365  tccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||| ||||||||||| ||||| |||||||| ||||||||||||||
Sbjct: 2816 tccgtttcagggtgtaagcttgacaaacatttaaggttgtgatgta 2771



to top

>dbj|AB097087.1| Glycine max GmPEPC15 gene for phosphoenolpyruvate carboxylase,
            complete cds
          Length = 7205

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| ||||||||||| || ||||| ||||| ||||
Sbjct: 7083 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagtgtgtcttcca 7029



to top

>dbj|D13998.1|SOYPEPC Glycine max gmppc1 mRNA for phosphoenolpyruvate carboxylase, complete
            cds
          Length = 3048

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| ||||||||||| || ||||| ||||| ||||
Sbjct: 2924 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagtgtgtcttcca 2870



to top

>gb|U65227.1|HVU65227 Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 2 mRNA,
            partial cds
          Length = 1091

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217  cccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgctcccatggtt 275
            |||||||| |||| |||||||||||||||||| ||||||||| |||| |||||| ||||
Sbjct: 1082 cccttcatggtcaagatgagggtgtcctccagtcctggggcatactcactcccagggtt 1024



to top

>dbj|AB008542.1| Glycine max mRNA for phosphoenolpyruvate carboxylase, partial cds,
           clone:GmPEPC15
          Length = 292

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 193 gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
           ||||||||||||||||||||||| ||||||||||| || ||||| ||||| ||||
Sbjct: 114 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagtgtgtcttcca 60



to top

>emb|X91631.1|AEPPCGENE A.eburneum mRNA for phosphoenolpyruvate carboxylase (aerial root)
          Length = 1068

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           ||||| ||||||||||| ||||||||||||||||||||||  ||||| ||||||
Sbjct: 935 tctctgatccgcttcagtgtgtaggcttggcaaacattcagagttgttatgtag 882



to top

>emb|AJ252947.1|KPAJ2947 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1116

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||| || ||||| ||||| |||||||||||||||||||||||
Sbjct: 1103 tgcatgccagcggcgatgcctttcattgtcaggatgagggtgtcctccag 1054



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 370 ttcagggtgtaggcttggcaaacattca 397
           |||||||||||||| ||||| |||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattca 899



to top

>emb|AJ231295.1|KPAJ1295 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1116

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||| || ||||| ||||| |||||||||||||||||||||||
Sbjct: 1103 tgcatgccagcggcgatgcctttcattgtcaggatgagggtgtcctccag 1054



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 370 ttcagggtgtaggcttggcaaacattca 397
           |||||||||||||| ||||| |||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattca 899



to top

>dbj|AB078718.1| Nicotiana sylvestris Nsppc1 gene for phosphoenolpyruvate carboxylase,
            partial cds
          Length = 4589

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                        
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggg 255
            |||||||| ||||||||||| |||||||| |||| |||||| |||||||||| ||| |||
Sbjct: 4055 ttctgcattccagcagcaatacccttcatggtcaagatgagtgtgtcctccaagccaggg 3996

              
Query: 256  gc 257
            ||
Sbjct: 3995 gc 3994



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 367  cgcttcagggtgtaggcttggcaaacattcaaggttgtgat 407
            ||||| ||||||||||||||||| || ||||| ||||||||
Sbjct: 3884 cgctttagggtgtaggcttggcacacgttcaaagttgtgat 3844



to top

>ref|NM_188369.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2331

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                        
Query: 188  agcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||| |||||||||||||| || || ||||||||||| || |||||||| ||||||||||
Sbjct: 2329 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 2270

             
Query: 248  g 248
            |
Sbjct: 2269 g 2269



to top

>emb|X91406.1|TUPPC T.usneoides mRNA for phosphoenolpyruvate decarboxylase
          Length = 2028

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                 
Query: 211  gcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||||||||||||| ||||||||||||||||||||||
Sbjct: 2024 gcaatgcccttcatggtcaggatgagggtgtcctcca 1988



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 355  gggtctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgt 404
            |||||||| ||||||||| | ||||| ||||||||||| ||||| |||||
Sbjct: 1880 gggtctctaatccgcttcggtgtgtaagcttggcaaacgttcaaagttgt 1831



to top

>emb|AJ312683.1|KFE312683 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 6
          Length = 1092

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||| ||||| |||||||||||||||||||||||||| ||||||
Sbjct: 1085 atgcctttcatggtcaggatgagggtgtcctccaggccaggggca 1041



to top

>emb|AJ312681.1|KFE312681 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 4
          Length = 714

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 214 atgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
           ||||| ||||| |||||||||||||||||||||||||| ||||||
Sbjct: 707 atgcctttcatggtcaggatgagggtgtcctccaggccaggggca 663



to top

>emb|AJ312680.1|KFE312680 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 3
          Length = 1095

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||||||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1088 atgcccttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ312633.1|KDA312633 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 2
          Length = 1092

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||| ||||| |||||||||||||||||||||||||| ||||||
Sbjct: 1085 atgcctttcattgtcaggatgagggtgtcctccaggccaggggca 1041



to top

>emb|AJ417435.1|CSA417435 Cucumis sativus partial mRNA for phosphoenolpyruvate carboxylase
           (pepc1 gene)
          Length = 932

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 193 gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
           ||||||||||| ||||||||||| |||||||| |||| ||| |||||||||||
Sbjct: 590 gtgttctgcattccagcagcaatacccttcatggtcaagatcagggtgtcctc 538



to top

>emb|AJ252945.1|KGAJ2945 Kalanchoe grandiflora partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1095

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 1094 gcagcaatgcctttcatggtcaggatgagggtgtcctccag 1054



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 370 ttcagggtgtaggcttggcaaacattca 397
           |||||||||||||| ||||| |||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattca 899



to top

>emb|AJ252924.1|KSAJ2924 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1095

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||||||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1088 atgcccttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ252914.1|KKAJ2914 Kalanchoe kewensis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            |||||||| |||||||| |||||||||||||||||||||||
Sbjct: 1094 gcagcaatacccttcatggtcaggatgagggtgtcctccag 1054



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 370 ttcagggtgtaggcttggcaaacattca 397
           |||||||||||||| ||||| |||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattca 899



to top

>emb|AJ231296.1|PFAJ1296 Polytrichum formosum partial mRNA for phosphoenolpyruvate
            carboxylase, clone pPF20.1
          Length = 1110

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcc 251
            |||||||||||||| ||||||||||| || |||||||| |||||||| |||||
Sbjct: 1097 tgcatgccagcagcgatgcccttcattgtaaggatgagagtgtcctcaaggcc 1045



to top

>emb|AJ231294.1|PCAJ1294 Polytrichum commune partial mRNA for phosphoenolpyruvate carboxylase,
            clone pPC21.1
          Length = 1110

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcc 251
            |||||||||||||| ||||||||||| || |||||||| |||||||| |||||
Sbjct: 1097 tgcatgccagcagcgatgcccttcatggtaaggatgagagtgtcctcgaggcc 1045



to top

>dbj|AP003052.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OSJNBa0016I09
          Length = 148517

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                          
Query: 188    agcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
              |||| |||||||||||||| || || ||||||||||| || |||||||| ||||||||||
Sbjct: 112008 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 111949

               
Query: 248    g 248
              |
Sbjct: 111948 g 111948



to top

>dbj|AK066635.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071A07, full
            insert sequence
          Length = 3495

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                        
Query: 188  agcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||| |||||||||||||| || || ||||||||||| || |||||||| ||||||||||
Sbjct: 3202 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 3143

             
Query: 248  g 248
            |
Sbjct: 3142 g 3142



to top

>emb|Y15897.1|TAPEPC Triticum aestivum mRNA for phosphoenolpyruvate carboxykinase,
           partial
          Length = 1148

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193 gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
           ||||||||||  || ||||||||||||||||| |||| ||||||||| ||||||||
Sbjct: 982 gtgttctgcagaccggcagcaatgcccttcatggtcaagatgagggtatcctccag 927



to top

>emb|X61489.1|ZMPHOPCAR Zea mays pep gene for (C3 type) phosphoenolpyruvate carboxylase
          Length = 3213

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            |||||||| | ||| || || ||||||||||| |||||||||||||||||||||||
Sbjct: 2997 gtgttctggaggccggctgctatgcccttcatggtcaggatgagggtgtcctccag 2942



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||||||||||||||| ||||| || |||| ||| ||||||||
Sbjct: 2823 atccgcttcagggtgtaggcctggcagacgttcagggtggtgatgta 2777



to top

>emb|AJ231284.1|DSAJ1284 Dicranum scoparium partial mRNA for phosphoenolpyruvate carboxylase,
            clone pDS23.3
          Length = 1107

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctgg 254
            |||||||||||||| ||||| ||||| || |||||||| ||||||||||| |||||
Sbjct: 1094 tgcatgccagcagctatgcctttcatggtgaggatgagagtgtcctccagtcctgg 1039



to top

>emb|AJ312670.1|LBI312670 Leptotes bicolor partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 3
          Length = 1092

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 355 gggtctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||| ||||| |||||||||||||| ||||| |||||||  |||||||||||
Sbjct: 941 gggtctctgatccgtttcagggtgtaggcctggcacacattcagagttgtgatgta 886



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1085 atgcctttcattgtcaggatgagggtgtcctccagcccaggagcatactcgct 1033



to top

>emb|AJ312660.1|ETI312660 Euphorbia tirucalli partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 4
          Length = 1095

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 211  gcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            |||||||| ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1091 gcaatgcctttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ252928.1|VAAJ2928 Vanilla aphylla partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            ||||| ||||||||||| || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 1091 gcagcgatgcccttcatggttaggatgagggtgtcctccagccctggagcatactc 1036



to top

>gb|AF008940.1|AF008940 Gossypium hirsutum phosphoenolpyruvate carboxylase 2 (PEPC2) mRNA,
           partial cds
          Length = 577

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 200 gcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
           |||| ||||||||||| |||||||| |||| |||||||||||||||||
Sbjct: 577 gcattccagcagcaatacccttcatggtcaagatgagggtgtcctcca 530



to top

>gb|AC125474.16| Medicago truncatula clone mth2-16l11, complete sequence
          Length = 127369

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 193   gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
             ||||||||||||||||||||||| |||||||| || || ||||| ||||| ||||
Sbjct: 47576 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 47522



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 376   gtgtaggcttggcaaacattcaaggttgtgatgtag 411
             |||||||||||| ||||||| | |||||| ||||||
Sbjct: 47390 gtgtaggcttggaaaacattaagggttgtaatgtag 47355



to top

>gb|AC135231.23| Medicago truncatula clone mth2-28m10, complete sequence
          Length = 106771

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                    
Query: 193   gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
             |||||||||||||||||||| || |||||||| ||||| || ||||| |||||||
Sbjct: 95383 gtgttctgcatgccagcagctatacccttcattgtcagaataagggtatcctcca 95437



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 367   cgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
             |||||||| |||||||||||  | ||||| | ||||||||||||
Sbjct: 95560 cgcttcagtgtgtaggcttgcaagacattgagggttgtgatgta 95603



to top

>emb|Z71976.1|FTPPCC F.trinervia ppcC gene (partial)
          Length = 692

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
           ||||||||||| || ||||| || |||||||| |||| |||||||||||| ||||| || 
Sbjct: 107 gtgttctgcattcctgcagcgatacccttcatggtcaagatgagggtgtcttccagaccc 48

                          
Query: 253 ggggcaaactcgctc 267
           |||||  ||||||||
Sbjct: 47  ggggcgtactcgctc 33



to top

>emb|Z48966.1|FPPPCAMR F.pringlei ppcA mRNA for phosphoenolpyruvate carboxylase
          Length = 3256

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| || ||||| |||| |||||| ||||||||||
Sbjct: 3029 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 2975



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||| ||||| || ||||| || ||||| ||||||||||||||
Sbjct: 2852 atccgctttagggtataagcttgacatacatttaaggttgtgatgta 2806



to top

>emb|Z25853.1|FAPHOCAR F.australasica mRNA for phosphoenolpyruvate carboxylase
          Length = 3169

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| || ||||| |||| |||||| ||||||||||
Sbjct: 2928 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 2874



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||| ||| ||||| || |||||||| ||||||||||||||||||||
Sbjct: 2751 atcctctttagggtataagcttggcatacattcaaggttgtgatgta 2705



to top

>emb|X95856.1|NAPPC1 Neoregelia ampullacea mRNA for phosphoenolpyruvate carboxylase
          Length = 1104

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggc 257
            ||||||||||| || ||||| ||||| |||| |||||||||||||||||| || |||||
Sbjct: 1091 tgcatgccagccgcgatgcctttcatggtcaagatgagggtgtcctccagtccgggggc 1033



to top

>emb|X87149.1|VPPPCGE1 V.planifolia mRNA for phosphoenolpyruvate carboxylase, air roots
          Length = 3111

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||| ||||| ||||| || || |||||||| || |||||||||||||||||||| |||
Sbjct: 2864 gtgttttgcattccagctgctatccccttcattgtaaggatgagggtgtcctccagccct 2805

                       
Query: 253  ggggcaaactc 263
            || ||| ||||
Sbjct: 2804 ggagcatactc 2794



to top

>emb|X64144.2|FPPPCA Flaveria pringlei ppcA1 gene for phosphoenolpyruvate carboxylase
          Length = 10108

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| || ||||| |||| |||||| ||||||||||
Sbjct: 9615 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 9561



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| || ||||| |||| |||||| ||||||||||
Sbjct: 8551 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 8497



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||| ||||| || ||||| || ||||| ||||||||||||||
Sbjct: 9438 atccgctttagggtataagcttgacatacatttaaggttgtgatgta 9392



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||||||| ||||| || ||||| || ||||| ||||||||||||||
Sbjct: 8374 atccgctttagggtataagcttgacatacatttaaggttgtgatgta 8328



to top

>emb|X64143.2|FTPPCA Flaveria trinervia ppcA1 gene for phosphoenolpyruvate carboxylase
          Length = 9015

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| || ||||| |||| |||||| ||||||||||
Sbjct: 8291 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 8237



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||| ||| ||||| || |||||||| ||||||||||||||||||||
Sbjct: 8114 atcctctttagggtataagcttggcatacattcaaggttgtgatgta 8068



to top

>emb|X61304.1|FTPEPC F.trinervia mRNA for phosphoenolpyruvate carboxylase
          Length = 3174

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| || ||||| |||| |||||| ||||||||||
Sbjct: 2938 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 2884



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
            |||| ||| ||||| || |||||||| ||||||||||||||||||||
Sbjct: 2761 atcctctttagggtataagcttggcatacattcaaggttgtgatgta 2715



to top

>emb|X59016.1|NTPPC N.tabacum mRNA for phosphoenolpyruvate carboxylase
          Length = 3189

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                        
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggg 255
            |||||||  ||||||||||| |||||||| |||| |||||| |||||||||| ||| |||
Sbjct: 2940 ttctgcagtccagcagcaatacccttcattgtcaagatgagtgtgtcctccaagccgggg 2881

               
Query: 256  gca 258
            |||
Sbjct: 2880 gca 2878



to top

>emb|AJ312663.1|MEX312663 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 4
          Length = 1095

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 214  atgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||| |||||||||||||||||||||||
Sbjct: 1088 atgcccttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ312644.1|MCR312644 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 5
          Length = 1098

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 214  atgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||| |||||||||||||||||||||||
Sbjct: 1091 atgcccttcatggtcaggatgagggtgtcctccag 1057



to top

>emb|AJ417436.1|CSA417436 Cucumis sativus partial mRNA for phosphoenolpyruvate carboxylase
           (pepc2 gene)
          Length = 883

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 193 gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
           ||||||||||||||||||||||| |||||||| || |  ||||||||||| ||||
Sbjct: 590 gtgttctgcatgccagcagcaatacccttcatcgttaaaatgagggtgtcttcca 536



to top

>emb|AJ252926.1|KPAJ2926 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||| ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1094 gcagcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ231289.1|LCAJ1289 Lunularia cruciata partial mRNA for phosphoenolpyruvate carboxylase,
            clone pLC13.8
          Length = 1107

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                           
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            |||||||||||||| || |||||||| ||||||||||| ||||||||
Sbjct: 1094 tgcatgccagcagcgatacccttcatggtcaggatgagagtgtcctc 1048



to top

>emb|AJ011302.1|VFA011302 Vicia faba mRNA for phosphoenolpyruvate-carboxylase, pepc1 isoform
          Length = 3152

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| |||||||| || || ||||| ||||| ||||
Sbjct: 2911 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 2857



to top

>gb|AF512995.1| Citrus junos phosphoenolpyruvate carboxylase (pepc) mRNA, partial cds
          Length = 1490

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||||||||| |||||||||||| || ||||| |||| ||||||||| |||||||
Sbjct: 1226 gtgttctgcaagccagcagcaatacctttcatggtcaagatgagggtatcctcca 1172



to top

>gb|AF248080.1|AF248080 Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA,
            complete cds
          Length = 3372

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||||||||| || ||||| || |||||||| |||| |||||||||||| ||||| || 
Sbjct: 3064 gtgttctgcattcctgcagcgatacccttcatggtcaagatgagggtgtcttccagaccc 3005

                           
Query: 253  ggggcaaactcgctc 267
            |||||  ||||||||
Sbjct: 3004 ggggcgtactcgctc 2990



to top

>emb|AM237200.1| Lupinus luteus mRNA for phosphoenolpyrovate carboxylase (pepc2 gene)
          Length = 2907

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| |||||||| || || ||||||| ||| ||||
Sbjct: 2900 gtgttctgcatgccagcagcaatacccttcatggtgagaatgagggagtcttcca 2846



to top

>gb|AF135371.1|AF135371 Lotus corniculatus phosphoenol pyruvate carboxylase mRNA, complete
            cds
          Length = 3184

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| |||||||| || || || |||||||| ||||
Sbjct: 2936 gtgttctgcatgccagcagcaattcccttcatggtgagaatcagggtgtcttcca 2882



to top

>gb|M83086.1|ALFPPPCA Medicago sativa phosphoenolpyruvate carboxylase mRNA, complete cds
          Length = 3317

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| |||||||| || || ||||| ||||| ||||
Sbjct: 2999 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 2945



to top

>gb|L39371.1|ALFPEPC Medicago sativa phosphoenolpyruvate carboxylase (PEPC) gene, complete
            cds
          Length = 7490

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| |||||||| || || ||||| ||||| ||||
Sbjct: 6941 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 6887



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 376  gtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||| ||||||| | |||||| ||||||
Sbjct: 6755 gtgtaggcttggaaaacattaagggttgtaatgtag 6720



to top

>dbj|D64037.1|PEASPARKLE Pea mRNA for phosphoenolpyruvate carboxylase, complete cds
          Length = 3212

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||||||||||||||| |||||||| || || ||||| ||||| ||||
Sbjct: 2986 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 2932



to top

>gb|AC121246.28| Medicago truncatula clone mth2-35m8, complete sequence
          Length = 124137

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 193    gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtc 242
              ||||||||||||||||||||||| |||||||| || || ||||| |||||
Sbjct: 104197 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtc 104148



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 376    gtgtaggcttggcaaacattcaaggttgtgatgtag 411
              |||||||||||| ||||||| | |||||| ||||||
Sbjct: 104010 gtgtaggcttggaaaacattaagggttgtaatgtag 103975



to top

>emb|X91636.1|AEPPCGEN1 A.eburneum mRNA for phosphoenolpyruvate carboxylase (leaf)
          Length = 1065

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           ||||| || |||||||| ||||||||||||||||||||||  ||||| ||||||
Sbjct: 935 tctctgattcgcttcagtgtgtaggcttggcaaacattcagagttgttatgtag 882



to top

>emb|X91632.1|SAPPCGENE S.aphylla mRNA for phosphoenolpyruvate carboxylase
          Length = 1071

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           ||||| ||||||||||| |||||||||||| |||||||||  ||||| ||||||
Sbjct: 938 tctctcatccgcttcagtgtgtaggcttggaaaacattcagagttgttatgtag 885



to top

>gb|DQ320104.1| Clusia hilariana phosphoenolpyruvate carboxylase isoform 3 (pepc)
           mRNA, partial cds
          Length = 1092

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 350 agctggggtctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgt 409
           ||||||| ||||  ||||| ||||| |||||||||||||||||||| | ||| |||||||
Sbjct: 946 agctgggatctcgaatccgtttcagcgtgtaggcttggcaaacattaagggtggtgatgt 887

             
Query: 410 ag 411
           ||
Sbjct: 886 ag 885



to top

>emb|AJ312664.1|SAP312664 Solenangis aphylla partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 2
          Length = 1071

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           ||||| ||||||||||| |||||||||||| |||||||||  ||||| ||||||
Sbjct: 938 tctctcatccgcttcagtgtgtaggcttggaaaacattcagagttgttatgtag 885



to top

>emb|AJ312639.1|CUV312639 Clusia uvitana partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 4
          Length = 1092

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggc 257
            ||||||||||| ||||| |||| |||||||||||||||||  ||||||||
Sbjct: 1091 gcagcaatgcctttcatggtcaagatgagggtgtcctccaatcctggggc 1042



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||| ||| |||||||||||||||| | |||||| |||||
Sbjct: 932 atccgtttcagtgtgaaggcttggcaaacattaagggttgtaatgta 886



to top

>emb|AJ312638.1|CUV312638 Clusia uvitana partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 3
          Length = 1092

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggc 257
            ||||| ||||||||||| |||| |||||||||||||||||  ||||||||
Sbjct: 1091 gcagcgatgcccttcatggtcaagatgagggtgtcctccaatcctggggc 1042



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||| ||| |||||||||||||||| | |||||| |||||
Sbjct: 932 atccgtttcagtgtgaaggcttggcaaacattaagggttgtaatgta 886



to top

>emb|AJ312627.1|VPL312627 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 4
          Length = 1092

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            ||||||||||| || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 1085 atgcccttcatggtgaggatgagggtgtcctccagccctggagcatactc 1036



to top

>dbj|AB078719.1| Nicotiana sylvestris Nsppc2 gene for phosphoenolpyruvate carboxylase,
            partial cds
          Length = 5057

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggg 255
            |||||||| ||||||||||| |||||||| |||| |||||| ||||| |||| ||| |||
Sbjct: 4927 ttctgcattccagcagcaatacccttcatggtcaagatgagagtgtcttccaagccaggg 4868

              
Query: 256  gc 257
            ||
Sbjct: 4867 gc 4866



to top

>emb|AJ318342.1|SSP318342 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-2-1)
          Length = 573

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 214 atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgctcccatgg 273
           ||||||||||| ||||||||||||||||| ||||| || || ||  | ||||| ||| ||
Sbjct: 462 atgcccttcatggtcaggatgagggtgtcttccagccccggtgcgtattcgctgccaggg 403

                            
Query: 274 ttcagttgcaccagctc 290
           ||||| | |||||||||
Sbjct: 402 ttcagcttcaccagctc 386



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||||||||| ||||| || |||| ||| ||||||||
Sbjct: 309 atccgcttcagggtgtaggcctggcacacgttcagggtggtgatgta 263



to top

>emb|AJ007705.1|TAE7705 Triticum aestivum PEPC gene
          Length = 5845

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||||||||| |||| ||||||||| ||||||||
Sbjct: 5537 gcagcaatgcccttcatggtcaagatgagggtatcctccag 5497



to top

>emb|X90982.1|STPPC1 S.tuberosum ppc1 gene
          Length = 5920

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 367  cgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            ||||| |||||||||||||| || |||||||| ||||||||||||
Sbjct: 5715 cgctttagggtgtaggcttgacacacattcaatgttgtgatgtag 5671



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||||||| ||||||||||| || ||||| || | |||||| ||||||||||
Sbjct: 5886 ttctgcattccagcagcaatacctttcatggttaagatgagtgtgtcctcca 5835



to top

>emb|AJ312682.1|KFE312682 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 5
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1088 atgcctttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ312672.1|LBI312672 Leptotes bicolor partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 5
          Length = 1086

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||||||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtatgcttggcaaacattcagagttgttatgta 886



to top

>emb|AJ312671.1|LBI312671 Leptotes bicolor partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 4
          Length = 1086

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||||||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtatgcttggcaaacattcagagttgttatgta 886



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||| ||||| ||||  ||||||||||| |||||
Sbjct: 1085 gcagcaatgcctttcatggtcaaaatgagggtgtcttccag 1045



to top

>emb|AJ312668.1|LBI312668 Leptotes bicolor partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 1
          Length = 870

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 208 gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
           ||||| ||||| ||||| |||||||||||||||||||||||
Sbjct: 869 gcagcgatgcctttcatggtcaggatgagggtgtcctccag 829



to top

>emb|AJ312656.1|TUS312656 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 4
          Length = 1089

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 211  gcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||| |||||||| ||||||||||||||||||||||
Sbjct: 1085 gcaatccccttcatggtcaggatgagggtgtcctcca 1049



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 355 gggtctcttatccgcttcagggtgtaggcttggcaaac 392
           |||||||| ||||||||||| ||||| |||||||||||
Sbjct: 941 gggtctctaatccgcttcagtgtgtaagcttggcaaac 904



to top

>emb|AJ312646.1|KPI312646 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform A
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1088 atgcctttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ312634.1|KDA312634 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 3
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1088 atgcctttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ312617.1|CRE312617 Cycas revoluta partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 2
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||| ||||| ||||| |||||||||||||||||||||||
Sbjct: 1094 gcagcgatgcctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ344052.1|KPI344052 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (ppc gene), isogene 1
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1088 atgcctttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ318343.1|SSP318343 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-2-2)
          Length = 537

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 214 atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgctcccatgg 273
           ||||||||||| ||||||||||||||||| ||||| || || ||  | ||||| ||| ||
Sbjct: 469 atgcccttcatggtcaggatgagggtgtcttccagccccggtgcgtattcgctgccaggg 410

                            
Query: 274 ttcagttgcaccagctc 290
           ||||| | |||||||||
Sbjct: 409 ttcagcttcaccagctc 393



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||||||||| ||||| || |||| ||| ||||||||
Sbjct: 316 atccgcttcagggtgtaggcctggcacacgttcagggtggtgatgta 270



to top

>emb|AJ252944.1|DDAJ2944 Dendrobium delicatum partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1092

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||||||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtaagcttggcaaacattcagagttgttatgta 886



to top

>emb|AJ252922.1|KPAJ2922 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||| ||||| ||||| |||||||||||||||||||||||
Sbjct: 1094 gcagcgatgcctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ252920.1|KPAJ2920 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||| ||||| ||||| |||||||||||||||||||||||
Sbjct: 1094 gcagcgatgcctttcatggtcaggatgagggtgtcctccag 1054



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ252919.1|KPAJ2919 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||| ||||| ||||| |||||||||||||||||||||||
Sbjct: 1094 gcagcgatgcctttcatggtcaggatgagggtgtcctccag 1054



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ252915.1|KKAJ2915 Kalanchoe kewensis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||| ||||| ||||| |||||||||||||||||||||||
Sbjct: 1094 gcagcgatgcctttcatggtcaggatgagggtgtcctccag 1054



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 370 ttcagggtgtaggcttggcaaacattca 397
           |||||||||||||| ||||| |||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattca 899



to top

>emb|AJ231291.1|LPAJ1291 Leptobryum pyriforme partial mRNA for phosphoenolpyruvate
            carboxylase, clone pLP1.1
          Length = 1101

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            |||||||||||||| || || ||||| || ||||||| ||||||||||| ||| || |||
Sbjct: 1088 tgcatgccagcagcgatccctttcatggtgaggatgacggtgtcctccaagccaggcgca 1029

                 
Query: 259  aactc 263
            |||||
Sbjct: 1028 aactc 1024



to top

>dbj|D10717.1|SOYGMPPC Glycine max mRNA for phosphoenolpyruvate carboxylase, complete cds
          Length = 3211

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                        
Query: 187  tagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcc 246
            ||||| ||||| |||| |||||||||||| |||||||| || || ||||||||||| |||
Sbjct: 3019 tagccagtgttttgcaagccagcagcaatacccttcatggtgagaatgagggtgtcttcc 2960

             
Query: 247  a 247
            |
Sbjct: 2959 a 2959



to top

>gb|AY349322.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>gb|AY349321.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>gb|AY349316.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1086



to top

>gb|AY349312.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>gb|AY349311.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>gb|AY349310.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>gb|AY349308.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>gb|AY349306.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>gb|AY349304.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1153

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1140 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1085



to top

>gb|AY349303.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>gb|AY349302.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1086



to top

>gb|AY349298.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccag 1083



to top

>emb|X87819.1|KBRNAPPC2 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase  (Kb2)
          Length = 1095

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 207  agcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            |||||| || || ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1095 agcagcgatacctttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|X87818.1|KBRNAPPC1 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase  (Kb1)
          Length = 1095

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 207  agcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            |||||| || || ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1095 agcagcgatacctttcattgtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|X14587.1|MCPPCA Mesembryanthemum crystallinum ppc1 gene for phosphoenolpyruvate
            carboxylase (EC 4.1.1.31)
          Length = 7694

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| || |||||||| ||||| | |||||||||||||
Sbjct: 7070 atccgcttcagggtatacgcttggcagacattgagggttgtgatgtag 7023



to top

>emb|X13660.1|MCPPCR Mesembryanthemum crystallinum mRNA for phosphoenolpyruvate
            carboxylase (EC 4.1.1.31)
          Length = 3348

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 364  atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            |||||||||||||| || |||||||| ||||| | |||||||||||||
Sbjct: 2721 atccgcttcagggtatacgcttggcagacattgagggttgtgatgtag 2674



to top

>emb|AJ312661.1|MEX312661 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 2
          Length = 1095

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 217  cccttcatagtcaggatgagggtgtcctccag 248
            |||||||| |||||||||||||||||||||||
Sbjct: 1085 cccttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ312654.1|TUS312654 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 2
          Length = 1089

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||| || |||||||| ||||||||||||||||||||||
Sbjct: 1088 gcagcgatacccttcatggtcaggatgagggtgtcctcca 1049



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 355 gggtctcttatccgcttcagggtgtaggcttggcaaac 392
           |||||||| ||||||||||| ||||| |||||||||||
Sbjct: 941 gggtctctaatccgcttcagtgtgtaagcttggcaaac 904



to top

>emb|AJ312653.1|TUS312653 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 1
          Length = 1089

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||| || |||||||| ||||||||||||||||||||||
Sbjct: 1088 gcagcgatacccttcatggtcaggatgagggtgtcctcca 1049



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 355 gggtctcttatccgcttcagggtgtaggcttggcaaac 392
           |||||||| ||||||||||| ||||| |||||||||||
Sbjct: 941 gggtctctaatccgcttcagtgtgtaagcttggcaaac 904



to top

>emb|AJ312643.1|MCR312643 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 4
          Length = 1092

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           |||||||||||||| || |||||||| ||||| | |||||||||||||
Sbjct: 932 atccgcttcagggtatacgcttggcagacattgagggttgtgatgtag 885



to top

>emb|AJ312642.1|MCR312642 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 3
          Length = 1092

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           |||||||||||||| || |||||||| ||||| | |||||||||||||
Sbjct: 932 atccgcttcagggtatacgcttggcagacattgagggttgtgatgtag 885



to top

>emb|AJ312640.1|MCR312640 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 1
          Length = 1089

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||| ||||| ||||| ||||||||||||||||||||||
Sbjct: 1088 gcagcgatgcctttcatggtcaggatgagggtgtcctcca 1049



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 355 gggtctcttatccgcttcagggtgtaggcttggcaaac 392
           |||||||| ||||||||||| ||||| |||||||||||
Sbjct: 941 gggtctctaatccgcttcagtgtgtaagcttggcaaac 904



to top

>emb|AJ312624.1|VPL312624 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 1
          Length = 1092

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            ||||| || |||||||| || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 1091 gcagcgatacccttcatggtgaggatgagggtgtcctccagccctggagcatactc 1036



to top

>emb|AJ252932.1|VPAJ2932 Vanilla phalaenopsis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            ||||| ||||| ||||| || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 1091 gcagcgatgcctttcatggttaggatgagggtgtcctccagccctggagcatactc 1036



to top

>emb|AJ252930.1|VPAJ2930 Vanilla phalaenopsis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            ||||| ||||| ||||| || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 1091 gcagcgatgcctttcatggttaggatgagggtgtcctccagccctggagcatactc 1036



to top

>emb|AJ252927.1|VAAJ2927 Vanilla aphylla partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1086

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            ||||| ||||||||||| || |||||||||||||| ||||| || |||||| ||||
Sbjct: 1085 gcagcgatgcccttcatggttaggatgagggtgtcttccagcccaggggcatactc 1030



to top

>emb|AJ252921.1|KPAJ2921 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 217  cccttcatagtcaggatgagggtgtcctccag 248
            |||||||| |||||||||||||||||||||||
Sbjct: 1085 cccttcatggtcaggatgagggtgtcctccag 1054



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           |||||||||||||| ||||| |||||||  || ||||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>gb|AY663388.1| Lupinus albus phosphoenolpyruvate carboxylase 4 mRNA, complete cds
          Length = 3288

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 193  gtgttctgcatgccagcagcaatgcccttcat 224
            ||||||||||||||||||||||| ||||||||
Sbjct: 3033 gtgttctgcatgccagcagcaatacccttcat 3002



to top

>gb|AY663387.1| Lupinus albus phosphoenolpyruvate carboxylase 3 mRNA, complete cds
          Length = 3320

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 193  gtgttctgcatgccagcagcaatgcccttcat 224
            ||||||||||||||||||||||| ||||||||
Sbjct: 3074 gtgttctgcatgccagcagcaatacccttcat 3043



to top

>emb|X95861.1|VPPPC1 Vanilla planifolia mRNA for phosphoenolpyruvate carboxylase
          Length = 1089

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 217  cccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            |||||||| || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 1079 cccttcattgtaaggatgagggtgtcctccagccctggagcatactc 1033



to top

>emb|X14588.1|MCPPCB Mesembryanthemum crystallinum ppc2 gene for phosphoenolpyruvate
            carboxylase (EC 4.1.1.31)
          Length = 8050

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||||||||| ||||| ||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 7582 gtgttctgcattccagctgcaatacccttcatggtgaggatgagtgtgtcttcaagaccc 7523

                       
Query: 253  ggggcaaactc 263
            |||||| ||||
Sbjct: 7522 ggggcatactc 7512



to top

>gb|DQ320106.1| Clusia multiflora phosphoenolpyruvate carboxylase (pepc) mRNA,
           partial cds
          Length = 1092

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||| |||||||||||||||||||| | |||||| |||||
Sbjct: 932 atccgtttcagcgtgtaggcttggcaaacattaagggttgtaatgta 886



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 220  ttcatagtcaggatgagggtgtcctccaggcctggggc 257
            ||||| |||| |||||||||||||||||  ||||||||
Sbjct: 1079 ttcatggtcaagatgagggtgtcctccaatcctggggc 1042



to top

>gb|DQ320105.1| Clusia minor phosphoenolpyruvate carboxylase (pepc) mRNA, partial
           cds
          Length = 1092

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||| |||||||||||||||||||| | |||||| |||||
Sbjct: 932 atccgtttcagtgtgtaggcttggcaaacattaagggttgtaatgta 886



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 214  atgcccttcatagtcaggatgagggtgtcctcca 247
            ||||| ||||| |||| |||||||||||||||||
Sbjct: 1085 atgcctttcatggtcaagatgagggtgtcctcca 1052



to top

>gb|DQ320102.1| Clusia hilariana phosphoenolpyruvate carboxylase isoform 1 (pepc)
           mRNA, partial cds
          Length = 1092

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||| |||||||||||||||||||| | |||||| |||||
Sbjct: 932 atccgtttcagcgtgtaggcttggcaaacattaagggttgtaatgta 886



to top

>gb|AY950667.1| Alternanthera sessilis phosphoenolpyruvate carboxylase (PPCA) mRNA,
            complete cds
          Length = 3473

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcc 251
            ||||||||||| ||||| ||||| ||||||||||||| ||| || ||||| || |||||
Sbjct: 3098 gtgttctgcataccagccgcaatacccttcatagtcaagataagagtgtcttcgaggcc 3040



to top

>emb|AJ312679.1|KFE312679 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 2
          Length = 1095

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 220  ttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1082 ttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ312662.1|MEX312662 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 3
          Length = 1095

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 214  atgcccttcatagtcaggatgagggtgtcctccag 248
            ||||| ||||| |||||||||||||||||||||||
Sbjct: 1088 atgcctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ312649.1|KPI312649 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform D
          Length = 1095

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 220  ttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1082 ttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ312647.1|KPI312647 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform B
          Length = 1092

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||| ||||| ||||| || || |||||||||||||||||||| ||||||
Sbjct: 1091 gcagcgatgcctttcatggtgagaatgagggtgtcctccaggccaggggca 1041



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           ||||||||||| || || || |||||| ||||||  ||||||||||||
Sbjct: 932 atccgcttcagtgtatatgcctggcaagcattcagagttgtgatgtag 885



to top

>emb|AJ312626.1|VPL312626 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 3
          Length = 1092

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 217  cccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            |||||||| || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 1082 cccttcatggtgaggatgagggtgtcctccagccctggagcatactc 1036



to top

>emb|AJ344055.1|KPI344055 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (ppc gene), isogene 4
          Length = 1095

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 220  ttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
            ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 1082 ttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 1036



to top

>emb|AJ344053.1|KPI344053 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (ppc gene), isogene 2
          Length = 1092

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||| ||||| ||||| || || |||||||||||||||||||| ||||||
Sbjct: 1091 gcagcgatgcctttcatggtgagaatgagggtgtcctccaggccaggggca 1041



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           ||||||||||| || || || |||||| ||||||  ||||||||||||
Sbjct: 932 atccgcttcagtgtatatgcctggcaagcattcagagttgtgatgtag 885



to top

>emb|AJ252925.1|KSAJ2925 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1092

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 220  ttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||| ||||| |||||||||||||||||||| ||||||
Sbjct: 1079 ttcattgtcagaatgagggtgtcctccaggccaggggca 1041



to top

>emb|AJ011303.1|VFA011303 Vicia faba mRNA for phosphoenolpyruvate-carboxylase, pepc2 isoform,
            partial
          Length = 2247

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||| |||| |||||||||||| |||||||| || || ||||||||||| ||||
Sbjct: 2109 gtgttttgcaagccagcagcaatacccttcatggtgagaatgagggtgtcttcca 2055



to top

>gb|AF268091.1|AF268091 Chloris gayana phosphoenolpyruvate carboxylase (ppc) mRNA, complete
            cds
          Length = 3137

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                        
Query: 186  ctagcctgtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctc 245
            |||||| ||||||||||| || || || || |||||||| || | |||||||||||||||
Sbjct: 2887 ctagccggtgttctgcataccggcggcgatacccttcatggtgatgatgagggtgtcctc 2828

               
Query: 246  cag 248
            |||
Sbjct: 2827 cag 2825



to top

>dbj|AB078720.3| Nicotiana sylvestris Nsppc3 gene for phosphoenolpyruvate carboxylase,
            partial cds
          Length = 3399

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                        
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggg 255
            |||||||  ||||||||||| |||||||| |||| |||||| |||||||| | ||| |||
Sbjct: 2811 ttctgcagtccagcagcaatacccttcatcgtcaagatgagtgtgtcctctaagccgggg 2752

               
Query: 256  gca 258
            |||
Sbjct: 2751 gca 2749



to top

>emb|AM235211.1| Lupinus luteus mRNA for phosphoenolpyruvate carboxylase (PEPC1 gene),
            clone LUP1
          Length = 2904

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 205  ccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| |||||||| || |||||||||||||| ||||
Sbjct: 2885 ccagcagcaatacccttcatggtgaggatgagggtgtcttcca 2843



to top

>dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT31E21, TM0340,
              complete sequence
          Length = 120480

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                     
Query: 193    gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
              ||||| |||||||| |||||||| |||||||| || || ||||||||||| ||||
Sbjct: 103616 gtgttttgcatgccggcagcaatacccttcatggtgagaatgagggtgtcttcca 103670



to top

>dbj|AP006074.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT40O02, TM0111b,
             complete sequence
          Length = 92724

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                    
Query: 193   gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
             ||||||||||| ||||||||||| |||||||| || || || |||||||| ||||
Sbjct: 42422 gtgttctgcattccagcagcaattcccttcatggtgagaatcagggtgtcttcca 42476



to top

>dbj|AB092821.1| Lotus japonicus LjPEPC2 mRNA for phosphoenolpyruvate carboxylase,
            complete cds
          Length = 3158

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||| |||||||| |||||||| |||||||| || || ||||||||||| ||||
Sbjct: 2914 gtgttttgcatgccggcagcaatacccttcatggtgagaatgagggtgtcttcca 2860



to top

>dbj|AB092820.1| Lotus japonicus LjPEPC1 mRNA for phosphoenolpyruvate carboxylase,
            complete cds
          Length = 3202

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            ||||||||||| ||||||||||| |||||||| || || || |||||||| ||||
Sbjct: 2971 gtgttctgcattccagcagcaattcccttcatggtgagaatcagggtgtcttcca 2917



to top

>emb|AJ001028.1|KFPEPC458 Kalanchoe fedtschenkoi mRNA for phosphoenolpyruvate carboxylase
           (458bp)
          Length = 458

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 220 ttcatagtcaggatgagggtgtcctccaggcctggggcaaactcgct 266
           ||||| ||||||||||||||||||||||| || || ||| |||||||
Sbjct: 13  ttcatggtcaggatgagggtgtcctccagaccaggagcatactcgct 59



to top

>emb|AJ312673.1|ABA312673 Aloe vera partial mRNA for phosphoenolpyruvate carboxylase (pepc
           gene), isoform 1
          Length = 1017

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           ||||| || |||||||| ||||| |||||||| || ||||||||||| ||||||
Sbjct: 863 tctctgatgcgcttcagagtgtatgcttggcacacgttcaaggttgttatgtag 810



to top

>emb|AJ312630.1|ACO312630 Ananas comosus partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 3
          Length = 1089

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 355 gggtctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgt 404
           |||||||| ||||||||||| ||||| |||||||| || ||||| |||||
Sbjct: 941 gggtctctaatccgcttcagtgtgtaagcttggcagacgttcaaagttgt 892



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 217  cccttcatagtcaggatgagggtgtcctccaggcctggggc 257
            |||||||| |||| |||||||||||||||||| || |||||
Sbjct: 1079 cccttcatggtcaagatgagggtgtcctccagtccgggggc 1039



to top

>emb|AJ252929.1|VPAJ2929 Vanilla pompona partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            ||||| ||||| || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 1085 atgcctttcatggtgaggatgagggtgtcctccagccctggagcatactc 1036



to top

>emb|AJ231299.1|SBAJ1299 Symphyogyna brongniartii partial mRNA for phosphoenolpyruvate
            carboxylase, clone pSB2.1
          Length = 1128

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            |||||||||||||| ||||||||||| || |  ||||| ||||| ||||| || |||| |
Sbjct: 1115 tgcatgccagcagcgatgcccttcattgtgataatgagagtgtcttccagaccgggggga 1056

                  
Query: 259  aactcg 264
            ||||||
Sbjct: 1055 aactcg 1050



to top

>emb|AJ231282.1|CCAJ1282 Calliergonella cuspidata partial mRNA for phosphoenolpyruvate
            carboxylase, clone pCC25.1
          Length = 1110

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||| |||||||| ||||| || ||||| | ||||||||||||
Sbjct: 1097 tgcatgccagctgcaatgcctttcatggtaaggatcatggtgtcctccag 1048



to top

>gb|AF530570.1| X Mokara cv. 'Yellow' phosphoenolpyruvate carboxylase (PEPC) mRNA,
            complete cds
          Length = 3443

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 358  tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            ||||| ||||| ||||| |||||||||||| |||||||||  ||||| ||||||
Sbjct: 3061 tctctgatccgtttcagtgtgtaggcttggtaaacattcagagttgttatgtag 3008



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccag 248
            ||||||||||  || ||||| ||||||||||| ||||  || |||||||| |||||
Sbjct: 3220 gtgttctgcagacccgcagctatgcccttcatggtcaaaataagggtgtcttccag 3165



to top

>gb|AF008939.1|AF008939 Gossypium hirsutum phosphoenolpyruvate carboxylase 1 (PEPC1) mRNA,
            complete cds
          Length = 3405

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                        
Query: 193  gtgttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcct 252
            ||||| ||||| ||||||||||| |||||||| ||||  || |||||||| ||||| || 
Sbjct: 3179 gtgttttgcattccagcagcaatacccttcatggtcaaaataagggtgtcttccagacca 3120

                          
Query: 253  ggggcaaactcgct 266
            || ||| |||||||
Sbjct: 3119 ggagcatactcgct 3106



to top

>emb|AJ312655.1|TUS312655 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 3
          Length = 1089

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 214  atgcccttcatagtcaggatgagggtgtcctcca 247
            ||||| ||||| ||||||||||||||||||||||
Sbjct: 1082 atgcctttcatggtcaggatgagggtgtcctcca 1049



to top

>emb|X67053.1|STPPC S.tuberosum ppc mRNA for phosphoenolpyruvate carboxylase
          Length = 3141

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 367  cgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            ||||| |||||||||||||| || || ||||| ||||||||||||
Sbjct: 2733 cgctttagggtgtaggcttgacacacgttcaatgttgtgatgtag 2689



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||||||| ||||||||||| || ||||| || | |||||| ||||||||||
Sbjct: 2904 ttctgcattccagcagcaatacctttcatggttaagatgagtgtgtcctcca 2853



to top

>emb|X95852.1|SSPPPC1 Sphagnum sp. HG-1998 mRNA for phosphoenolpyruvate carboxylase
          Length = 1107

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggt 239
            |||||||||||||| ||||||||||| |||| ||| |||||
Sbjct: 1094 tgcatgccagcagcgatgcccttcattgtcaagatcagggt 1054



to top

>emb|X95860.1|PAPPC1 Pereskia aculeata mRNA for phosphoenolpyruvate carboxylase
          Length = 1110

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 367 cgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
           |||||||||||||| |||||| | |||||||  ||||||||||||
Sbjct: 926 cgcttcagggtgtatgcttgggacacattcagagttgtgatgtag 882



to top

>emb|X91635.1|MEPPCGENE M.exilis mRNA for phosphoenolpyruvate carboxylase
          Length = 1089

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| |||||| |||||||||  ||||| |||||
Sbjct: 938 tctctgatccgcttcagtgtgtacgcttggaaaacattcagagttgttatgta 886



to top

>emb|X91634.1|VAPPCGENE V.aphylla mRNA for phosphoenolpyruvate carboxylase
          Length = 1086

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 211  gcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggcaaactc 263
            |||||||||||||| || ||||| |||||||| ||||| || |||||| ||||
Sbjct: 1082 gcaatgcccttcatggtaaggataagggtgtcttccagcccaggggcatactc 1030



to top

>gb|DQ320103.1| Clusia hilariana phosphoenolpyruvate carboxylase isoform 2 (pepc)
           mRNA, partial cds
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 350 agctggggtctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgt 409
           ||||||| ||||  ||||| ||||| ||||||| |||||||||||| | |||||| ||||
Sbjct: 946 agctgggatctcggatccgtttcagcgtgtaggattggcaaacattgagggttgtaatgt 887

            
Query: 410 a 410
           |
Sbjct: 886 a 886



to top

>emb|AJ312645.1|MCR312645 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 6
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 217  cccttcatagtcaggatgagggtgtcctccaggcctggggc 257
            |||||||| |||| |||||||||||||||||  ||||||||
Sbjct: 1082 cccttcattgtcaagatgagggtgtcctccaatcctggggc 1042



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 364 atccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||| ||| |||||||||||||||| | |||||| |||||
Sbjct: 932 atccgtttcagtgtgaaggcttggcaaacattaagggttgtaatgta 886



to top

>emb|AJ312628.1|ACO312628 Ananas comosus partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 2
          Length = 1089

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 217  cccttcatagtcaggatgagggtgtcctccaggcctggggc 257
            |||||||| |||| |||||||||||||||||| || |||||
Sbjct: 1079 cccttcatggtcaagatgagggtgtcctccagtccgggggc 1039



to top

>emb|AJ400987.1|EST400987 Epidendrum stamfordianum partial mRNA for phosphoenolpyruvate
           carboxylase (ppc gene)
          Length = 1113

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| |||||||| |||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagcgtgtacgcttggcagacattcagagttgttatgta 886



to top

>emb|AJ252943.1|DFAJ2943 Dendrobium fimbriatum partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||| ||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtaagcttgccaaacattcagagttgttatgta 886



to top

>emb|AJ252941.1|DMAJ2941 Dendrobium moschatum partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||| ||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtaagcttgccaaacattcagagttgttatgta 886



to top

>emb|AJ252940.1|DFAJ2940 Dendrobium farmeri partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||| ||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtaagcttgccaaacattcagagttgttatgta 886



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcc 251
            ||||| ||||||||||| ||||  || |||||||| ||||||||
Sbjct: 1091 gcagcgatgcccttcatggtcaaaatcagggtgtcttccaggcc 1048



to top

>emb|AJ252939.1|DFAJ2939 Dendrobium farmeri partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||| ||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtaagcttgccaaacattcagagttgttatgta 886



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 208  gcagcaatgcccttcatagtcaggatgagggtgtcctccaggcc 251
            ||||||||||| ||||| ||||  || |||||||| ||||||||
Sbjct: 1091 gcagcaatgcctttcatggtcaaaatcagggtgtcttccaggcc 1048



to top

>emb|AJ252936.1|DTAJ2936 Dendrobium thyrsifolium partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||| ||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtaagcttgccaaacattcagagttgttatgta 886



to top

>emb|AJ252935.1|DTAJ2935 Dendrobium thyrsifolium partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||| ||||||||||  ||||| |||||
Sbjct: 938 tctctaatccgcttcagtgtgtaagcttgccaaacattcagagttgttatgta 886



to top

>emb|AJ252934.1|DLAJ2934 Dendrobium loddigesii partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||| ||||||||||  ||||| |||||
Sbjct: 938 tctctcatccgcttcagtgtgtaagcttgccaaacattcagagttgttatgta 886



to top

>emb|AJ252933.1|DLAJ2933 Dendrobium loddigesii partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 358 tctcttatccgcttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||||||||||| ||||| ||||| ||||||||||  ||||| |||||
Sbjct: 938 tctctcatccgcttcagtgtgtaagcttgccaaacattcagagttgttatgta 886



to top

>emb|AJ252918.1|KGAJ2918 Kalanchoe grandiflora partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 220  ttcatagtcaggatgagggtgtcctccag 248
            ||||| |||||||||||||||||||||||
Sbjct: 1082 ttcatggtcaggatgagggtgtcctccag 1054



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 370 ttcagggtgtaggcttggcaaacattca 397
           |||||||||||||| ||||| |||||||
Sbjct: 926 ttcagggtgtaggcctggcacacattca 899



to top

>emb|AJ243416.1|LES243416 Lycopersicon esculentum mRNA for phosphoenolpyruvate carboxylase 1
            (ppc1 gene)
          Length = 3192

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 367  cgcttcagggtgtaggcttggcaaacattcaaggttgtgatgtag 411
            ||||| |||||||||||||| || || ||||| ||||||||||||
Sbjct: 2730 cgctttagggtgtaggcttgacacacgttcaatgttgtgatgtag 2686



to top

>emb|AJ231281.1|BSAJ1281 Brachythecium salebrosum partial mRNA for phosphoenolpyruvate
            carboxylase, clone pBS26.3
          Length = 1116

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            |||||||| ||||| ||||||||||| || ||||| | ||| ||||||| ||| ||||| 
Sbjct: 1103 tgcatgcccgcagcgatgcccttcatggtaaggatcatggtatcctccaagccaggggcg 1044

                 
Query: 259  aactc 263
            |||||
Sbjct: 1043 aactc 1039



to top

>gb|AF236126.1| Vitis vinifera PEP carboxylase (GPEPC) mRNA, partial cds
          Length = 1170

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 188  agcctgtgttctgcatgccagcagcaatgcccttcat 224
            |||| |||||||||| |||||||||||| ||||||||
Sbjct: 1018 agccagtgttctgcaagccagcagcaatacccttcat 982



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 353 tggggtctcttatccgcttcagggtgtaggcttggcaaacatt 395
           |||||||||  ||||||||||| ||||| |||||||| |||||
Sbjct: 850 tggggtctcggatccgcttcagtgtgtatgcttggcacacatt 808



to top

>gb|AY563044.1| Glycine max phosphoenolpyruvate carboxylase (PEPC4) mRNA, complete
            cds
          Length = 2901

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 199  tgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctccaggcctggggca 258
            ||||| ||||||||||| |||||||| ||||  || ||||||||||| || || || |||
Sbjct: 2888 tgcattccagcagcaatacccttcattgtcaaaataagggtgtcctcaagaccaggagca 2829

                    
Query: 259  aactcgct 266
             |||||||
Sbjct: 2828 tactcgct 2821



to top

>emb|AJ011844.1|STU011844 Solanum tuberosum ppc2 gene
          Length = 6244

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||||||| ||||||||||| || ||||| |||| |||||| ||||| ||||
Sbjct: 5807 ttctgcattccagcagcaatacctttcatggtcaagatgagtgtgtcttcca 5756



to top

>emb|X91140.1|STPPC2 S.tuberosum ppc2 gene
          Length = 1266

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||||||| ||||||||||| || ||||| |||| |||||| ||||| ||||
Sbjct: 1057 ttctgcattccagcagcaatacctttcatggtcaagatgagtgtgtcttcca 1006



to top

>emb|AJ312637.1|CUV312637 Clusia uvitana partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 2
          Length = 1092

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 214  atgcccttcatagtcaggatgagggtgtcctccaggcctggggc 257
            ||||| ||||| |||| |||||||||||||||||  ||||||||
Sbjct: 1085 atgcctttcatggtcaagatgagggtgtcctccaatcctggggc 1042



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 370 ttcagggtgtaggcttggcaaacattcaaggttgtgatgta 410
           ||||| ||| |||||||||||||||| | |||||| |||||
Sbjct: 926 ttcagtgtgaaggcttggcaaacattaagggttgtaatgta 886



to top

>emb|AJ313434.1|LES313434 Lycopersicon esculentum ppc2 gene for phosphoenolpyruvate carboxylase
            2, exons 1-10
          Length = 8250

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||||||| ||||||||||| || ||||| |||| |||||| ||||| ||||
Sbjct: 7424 ttctgcattccagcagcaatacctttcatggtcaagatgagtgtgtcttcca 7373



to top

>emb|AJ243417.1|LES243417 Lycopersicon esculentum mRNA for phosphoenolpyruvate carboxylase 2
            (ppc2 gene)
          Length = 3090

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 196  ttctgcatgccagcagcaatgcccttcatagtcaggatgagggtgtcctcca 247
            |||||||| ||||||||||| || ||||| |||| |||||| ||||| ||||
Sbjct: 2894 ttctgcattccagcagcaatacctttcatggtcaagatgagtgtgtcttcca 2843


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,229,986
Number of Sequences: 3902068
Number of extensions: 3229986
Number of successful extensions: 61098
Number of sequences better than 10.0: 293
Number of HSP's better than 10.0 without gapping: 294
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60516
Number of HSP's gapped (non-prelim): 561
length of query: 411
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 389
effective length of database: 17,147,199,772
effective search space: 6670260711308
effective search space used: 6670260711308
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top