ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl47h07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC113931.2| Homo sapiens chromosome 16 clone CTD-2330P21, com... 46 0.078
2gb|AC092130.3| Homo sapiens chromosome 16 clone RP11-148M9, comp... 46 0.078
3gb|AC167362.2| Mus musculus BAC clone RP23-74P17 from chromosome... 44 0.31
4gb|AC135036.2| Homo sapiens 3 BAC RP11-178L24 (Roswell Park Canc... 44 0.31
5gb|AC122046.2| Mus musculus BAC clone RP24-449N4 from 7, complet... 44 0.31
6ref|XM_947936.1| Theileria annulata strain Ankara hypothetical p... 42 1.2
7gb|AC108425.9| Mus musculus chromosome 1, clone RP23-119I1, comp... 40 4.8
8ref|XM_630539.1| Dictyostelium discoideum hypothetical protein (... 40 4.8
9gb|AY521625.1| Singapore grouper iridovirus, complete genome 40 4.8
10gb|AC102438.8| Mus musculus chromosome 5, clone RP24-137F10, com... 40 4.8
11gb|AC103621.6| Mus musculus chromosome 5, clone RP24-230J14, com... 40 4.8
12gb|AC149694.2| Bos taurus BAC CH240-423C21 (Children's Hospital... 40 4.8
13gb|AC133206.3| Mus musculus BAC clone RP23-110D10 from chromosom... 40 4.8
14gb|AC110822.6| Mus musculus BAC clone RP24-226H7 from chromosome... 40 4.8
15emb|CR974467.8| Pig DNA sequence from clone CH242-235B3 on chrom... 40 4.8
16ref|XM_759893.1| Theileria parva strain Muguga hypothetical prot... 40 4.8
17gb|AF077529.1| Caenorhabditis elegans cosmid C09E8, complete seq... 40 4.8
18emb|AL355390.4| Human DNA sequence from clone RP11-512C24 on chr... 40 4.8
19emb|BX547933.13| Zebrafish DNA sequence from clone DKEY-87L9 in ... 40 4.8
20gb|AE008921.2| Uncultured proteobacterium clone EBAC000-60D04 co... 40 4.8
21ref|NM_176575.1| Drosophila melanogaster Papilin CG33103-RA, tra... 40 4.8
22ref|NM_176574.1| Drosophila melanogaster Papilin CG33103-RB, tra... 40 4.8
23ref|NM_061355.2| Caenorhabditis elegans C09E8.2a (C09E8.2) mRNA,... 40 4.8
24gb|AF529180.1| Drosophila melanogaster extracellular matrix prot... 40 4.8
25gb|AF529179.1| Drosophila melanogaster extracellular matrix prot... 40 4.8
26gb|AC009213.5|AC009213 Drosophila melanogaster, chromosome 3R, r... 40 4.8
27gb|AF205357.1|AF205357 Drosophila melanogaster extracellular mat... 40 4.8
28emb|CT033761.14| Mouse DNA sequence from clone RP23-203P12 on ch... 40 4.8
29gb|AC131718.5| Mus musculus BAC clone RP23-171B16 from 6, comple... 40 4.8
30gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 10... 40 4.8
31gb|AY666015.1| Grouper iridovirus, complete genome 40 4.8
32gb|AC133947.3| Mus musculus BAC clone RP24-189I2 from 9, complet... 40 4.8
33gb|AC140287.3| Mus musculus BAC clone RP23-346L16 from 6, comple... 40 4.8

>gb|AC113931.2| Homo sapiens chromosome 16 clone CTD-2330P21, complete sequence
          Length = 100469

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 151   cagaattggggaaaagggagtgggtccaggc 181
             ||||||||||| ||||||| |||||||||||
Sbjct: 13980 cagaattggggcaaagggaatgggtccaggc 14010



to top

>gb|AC092130.3| Homo sapiens chromosome 16 clone RP11-148M9, complete sequence
          Length = 170514

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 151  cagaattggggaaaagggagtgggtccaggc 181
            ||||||||||| ||||||| |||||||||||
Sbjct: 4433 cagaattggggcaaagggaatgggtccaggc 4403



to top

>gb|AC167362.2| Mus musculus BAC clone RP23-74P17 from chromosome 7, complete sequence
          Length = 215537

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 131    acaacaacaacaattgactaca 152
              ||||||||||||||||||||||
Sbjct: 169000 acaacaacaacaattgactaca 168979



to top

>gb|AC135036.2| Homo sapiens 3 BAC RP11-178L24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 73388

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 99    cagatgatgactgaagaatttc 120
             ||||||||||||||||||||||
Sbjct: 12157 cagatgatgactgaagaatttc 12136



to top

>gb|AC122046.2| Mus musculus BAC clone RP24-449N4 from 7, complete sequence
          Length = 150101

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 131   acaacaacaacaattgactaca 152
             ||||||||||||||||||||||
Sbjct: 78424 acaacaacaacaattgactaca 78445



to top

>ref|XM_947936.1| Theileria annulata strain Ankara hypothetical protein (TA08040)
            partial mRNA
          Length = 1716

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 302  ccggccacgaaacaagaaaac 322
            |||||||||||||||||||||
Sbjct: 1621 ccggccacgaaacaagaaaac 1641



to top

>gb|AC108425.9| Mus musculus chromosome 1, clone RP23-119I1, complete sequence
          Length = 187230

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 334  gttacaggagcaaaactgag 353
            ||||||||||||||||||||
Sbjct: 1930 gttacaggagcaaaactgag 1949



to top

>ref|XM_630539.1| Dictyostelium discoideum hypothetical protein (DDB0219574), partial
            mRNA
          Length = 5154

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 126  attttacaacaacaacaatt 145
            ||||||||||||||||||||
Sbjct: 4189 attttacaacaacaacaatt 4208



to top

>gb|AY521625.1| Singapore grouper iridovirus, complete genome
          Length = 140131

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 135    caacaacaattgactacagaattg 158
              |||||||||| |||||||||||||
Sbjct: 133907 caacaacaatggactacagaattg 133930



to top

>gb|AC102438.8| Mus musculus chromosome 5, clone RP24-137F10, complete sequence
          Length = 205785

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    ggattttacaacaacaacaa 143
              ||||||||||||||||||||
Sbjct: 191456 ggattttacaacaacaacaa 191437



to top

>gb|AC103621.6| Mus musculus chromosome 5, clone RP24-230J14, complete sequence
          Length = 169247

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    ggattttacaacaacaacaa 143
              ||||||||||||||||||||
Sbjct: 165240 ggattttacaacaacaacaa 165259



to top

>gb|AC149694.2| Bos taurus  BAC CH240-423C21 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 186118

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    atgatgactgaagaatttct 121
              ||||||||||||||||||||
Sbjct: 177870 atgatgactgaagaatttct 177851



to top

>gb|AC133206.3| Mus musculus BAC clone RP23-110D10 from chromosome 1, complete sequence
          Length = 177383

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 334   gttacaggagcaaaactgag 353
             ||||||||||||||||||||
Sbjct: 67837 gttacaggagcaaaactgag 67818



to top

>gb|AC110822.6| Mus musculus BAC clone RP24-226H7 from chromosome 9, complete sequence
          Length = 144131

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    ggattttacaacaacaacaa 143
              ||||||||||||||||||||
Sbjct: 142942 ggattttacaacaacaacaa 142923



to top

>emb|CR974467.8| Pig DNA sequence from clone CH242-235B3 on chromosome 17, complete
             sequence
          Length = 158975

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 259   gcccctccctgtatgcctctgccc 282
             |||||||||||| |||||||||||
Sbjct: 38663 gcccctccctgtctgcctctgccc 38640



to top

>ref|XM_759893.1| Theileria parva strain Muguga hypothetical protein (TP02_0420)
            partial mRNA
          Length = 5232

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 56   catcagcacatacaaacaca 75
            ||||||||||||||||||||
Sbjct: 4392 catcagcacatacaaacaca 4373



to top

>gb|AF077529.1| Caenorhabditis elegans cosmid C09E8, complete sequence
          Length = 21615

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 114   gaatttctgcggattttaca 133
             ||||||||||||||||||||
Sbjct: 10708 gaatttctgcggattttaca 10727



to top

>emb|AL355390.4| Human DNA sequence from clone RP11-512C24 on chromosome 13 Contains a 60S
              ribosomal protein 21 (RPL21) pseudogene and a novel gene,
              complete sequence
          Length = 158951

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 31     tgtatattagctctgctcaa 50
              ||||||||||||||||||||
Sbjct: 152809 tgtatattagctctgctcaa 152790



to top

>emb|BX547933.13| Zebrafish DNA sequence from clone DKEY-87L9 in linkage group 2,
             complete sequence
          Length = 177199

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 125   gattttacaacaacaacaat 144
             ||||||||||||||||||||
Sbjct: 14739 gattttacaacaacaacaat 14720



to top

>gb|AE008921.2| Uncultured proteobacterium clone EBAC000-60D04 complete sequence
          Length = 103420

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 245   ggcagcgctacaaagcccct 264
             ||||||||||||||||||||
Sbjct: 68106 ggcagcgctacaaagcccct 68087



to top

>ref|NM_176575.1| Drosophila melanogaster Papilin CG33103-RA, transcript variant A
            (Ppn), mRNA
          Length = 9537

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 91   aactccagcagatgatgact 110
            ||||||||||||||||||||
Sbjct: 2223 aactccagcagatgatgact 2242



to top

>ref|NM_176574.1| Drosophila melanogaster Papilin CG33103-RB, transcript variant B
            (Ppn), mRNA
          Length = 9171

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 91   aactccagcagatgatgact 110
            ||||||||||||||||||||
Sbjct: 2223 aactccagcagatgatgact 2242



to top

>ref|NM_061355.2| Caenorhabditis elegans C09E8.2a (C09E8.2) mRNA, complete cds
          Length = 915

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 114 gaatttctgcggattttaca 133
           ||||||||||||||||||||
Sbjct: 54  gaatttctgcggattttaca 73



to top

>gb|AF529180.1| Drosophila melanogaster extracellular matrix protein papilin 3 mRNA,
            complete cds; alternatively spliced
          Length = 8697

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 91   aactccagcagatgatgact 110
            ||||||||||||||||||||
Sbjct: 1833 aactccagcagatgatgact 1852



to top

>gb|AF529179.1| Drosophila melanogaster extracellular matrix protein papilin 2 mRNA,
            complete cds; alternatively spliced
          Length = 8331

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 91   aactccagcagatgatgact 110
            ||||||||||||||||||||
Sbjct: 1833 aactccagcagatgatgact 1852



to top

>gb|AC009213.5|AC009213 Drosophila melanogaster, chromosome 3R, region 98D-98D, BAC clone
             BACR09F18, complete sequence
          Length = 182525

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    aactccagcagatgatgact 110
             ||||||||||||||||||||
Sbjct: 69103 aactccagcagatgatgact 69084



to top

>gb|AF205357.1|AF205357 Drosophila melanogaster extracellular matrix protein papilin mRNA,
            complete cds
          Length = 7100

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 91   aactccagcagatgatgact 110
            ||||||||||||||||||||
Sbjct: 1923 aactccagcagatgatgact 1942



to top

>emb|CT033761.14| Mouse DNA sequence from clone RP23-203P12 on chromosome 9, complete
              sequence
          Length = 208050

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    ggattttacaacaacaacaa 143
              ||||||||||||||||||||
Sbjct: 196854 ggattttacaacaacaacaa 196835



to top

>gb|AC131718.5| Mus musculus BAC clone RP23-171B16 from 6, complete sequence
          Length = 199299

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   ggattttacaacaacaacaa 143
             ||||||||||||||||||||
Sbjct: 96989 ggattttacaacaacaacaa 96970



to top

>gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 103 of 118 of the complete
              sequence
          Length = 239049

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 91     aactccagcagatgatgact 110
              ||||||||||||||||||||
Sbjct: 199482 aactccagcagatgatgact 199463



to top

>gb|AY666015.1| Grouper iridovirus, complete genome
          Length = 139793

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 135    caacaacaattgactacagaattg 158
              |||||||||| |||||||||||||
Sbjct: 122904 caacaacaatggactacagaattg 122927



to top

>gb|AC133947.3| Mus musculus BAC clone RP24-189I2 from 9, complete sequence
          Length = 168997

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   ggattttacaacaacaacaa 143
             ||||||||||||||||||||
Sbjct: 24198 ggattttacaacaacaacaa 24179



to top

>gb|AC140287.3| Mus musculus BAC clone RP23-346L16 from 6, complete sequence
          Length = 213473

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   ggattttacaacaacaacaa 143
             ||||||||||||||||||||
Sbjct: 11500 ggattttacaacaacaacaa 11481


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,546,568
Number of Sequences: 3902068
Number of extensions: 4546568
Number of successful extensions: 105872
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 105815
Number of HSP's gapped (non-prelim): 57
length of query: 361
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 339
effective length of database: 17,147,199,772
effective search space: 5812900722708
effective search space used: 5812900722708
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top