>gb|AC138456.5| Mus musculus BAC clone RP24-262P4 from 3, complete sequence
          Length = 166191

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 60    ctcaaaattctagttaattgat 81
             ||||||||||||||||||||||
Sbjct: 70238 ctcaaaattctagttaattgat 70217

>emb|AL353695.7| Human DNA sequence from clone RP11-17L7 on chromosome 9 Contains the 5'
             end of the FUBP3 gene for far upstream element (FUSE)
             binding protein 3 (FBP3) and a CpG island, complete
             sequence
          Length = 84661

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   aaaaactaaccattgcatggt 123
             |||||||||||||||||||||
Sbjct: 50640 aaaaactaaccattgcatggt 50660

>gb|AC007394.4| Homo sapiens BAC clone RP11-489G12 from 2, complete sequence
          Length = 171468

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   actaaccattgcatggttaaa 127
             |||||||||||||||||||||
Sbjct: 96929 actaaccattgcatggttaaa 96949

>gb|AE017137.1| Yersinia pestis biovar Medievalis str. 91001 section 11 of 16 of the
             complete genome
          Length = 291817

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   ctaaccattgcatggttaaa 127
             ||||||||||||||||||||
Sbjct: 63403 ctaaccattgcatggttaaa 63384

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     ctaaccattgcatggttaaa 127
               ||||||||||||||||||||
Sbjct: 1582027 ctaaccattgcatggttaaa 1582046

>gb|AC124675.9| Mus musculus chromosome 15, clone RP24-88M7, complete sequence
          Length = 207904

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    acaattctcaaaattctagt 73
             ||||||||||||||||||||
Sbjct: 69601 acaattctcaaaattctagt 69620

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 108     ctaaccattgcatggttaaa 127
               ||||||||||||||||||||
Sbjct: 3281270 ctaaccattgcatggttaaa 3281251

>emb|AL592551.10| Mouse DNA sequence from clone RP23-12I13 on chromosome 11, complete
              sequence
          Length = 215657

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    tcaaggctggcctagacgac 288
              ||||||||||||||||||||
Sbjct: 137571 tcaaggctggcctagacgac 137552

>emb|AJ414155.1| Yersinia pestis strain CO92 complete genome; segment 15/20
          Length = 205050

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   ctaaccattgcatggttaaa 127
             ||||||||||||||||||||
Sbjct: 37626 ctaaccattgcatggttaaa 37607

>emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in linkage group 3, complete
              sequence
          Length = 170964

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 21     agatattaaagcaaacaaac 40
              ||||||||||||||||||||
Sbjct: 129933 agatattaaagcaaacaaac 129914

>gb|AC132130.3| Mus musculus BAC clone RP23-324D11 from 18, complete sequence
          Length = 183998

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 169   atgagcgaatcattccagga 188
             ||||||||||||||||||||
Sbjct: 55266 atgagcgaatcattccagga 55247


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,493,686
Number of Sequences: 3902068
Number of extensions: 2493686
Number of successful extensions: 45364
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45322
Number of HSP's gapped (non-prelim): 42
length of query: 311
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 289
effective length of database: 17,147,199,772
effective search space: 4955540734108
effective search space used: 4955540734108
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)