ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl47d12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 52 0.001
2gb|AY224574.1| Oryza sativa (japonica cultivar-group) isolate 29... 52 0.001
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
4gb|AC137635.2| Genomic sequence for Oryza sativa, Nipponbare str... 52 0.001
5dbj|AK111951.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
6dbj|AK101270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
7gb|AC127364.3| Mus musculus BAC clone RP23-3F6 from chromosome 1... 48 0.017
8gb|AC146939.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.0
9gb|U00032.2| Caenorhabditis elegans cosmid F37A4, complete sequence 42 1.0
10gb|AC138364.8| Mus musculus chromosome 7, clone RP23-243D10, com... 42 1.0
11emb|AL356862.10| Human DNA sequence from clone RP11-1M19 on chro... 42 1.0
12emb|AL354826.6| Human DNA sequence from clone RP11-286M16 on chr... 42 1.0
13emb|Z35768.1|SCYBL007C S.cerevisiae chromosome II reading frame ... 42 1.0
14emb|Z22810.1|SCSLA1PA S.cerevisiae of Sla1p gene, complete CDS 42 1.0
15gb|S47695.1| YBL03-16=basic motif/leucine zipper domain protein ... 42 1.0
16dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.0
17gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.0
18gb|AC084323.28| Mus musculus strain C57BL/6J chromosome 2 clone ... 42 1.0
19emb|AL833786.8| Mouse DNA sequence from clone RP23-220D12 on chr... 42 1.0
20gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, c... 40 4.1
21gb|AC147143.2| Pan troglodytes BAC clone CH251-267L18 from Y, co... 40 4.1
22gb|AC141647.3| Mus musculus BAC clone RP23-64E12 from chromosome... 40 4.1
23gb|AC127224.3| Mus musculus BAC clone RP24-498F21 from chromosom... 40 4.1
24gb|AC099594.6| Mus musculus chromosome 15, clone RP23-458G7, com... 40 4.1
25gb|AC006338.6| Homo sapiens BAC clone RP11-539D10 from Y, comple... 40 4.1
26gb|AC118211.10| Mus musculus chromosome 8, clone RP24-223O5, com... 40 4.1
27emb|BX927312.7| Zebrafish DNA sequence from clone CH211-87G12 in... 40 4.1
28gb|AC147515.1| Pan troglodytes BAC clone CH251-558O8 from Y, com... 40 4.1
29gb|AC130543.3| Mus musculus BAC clone RP24-178J22 from chromosom... 40 4.1
30gb|AC106738.3| Homo sapiens chromosome 16 clone CTD-3032H12, com... 40 4.1
31gb|AC122292.4| Mus musculus BAC clone RP23-256J8 from 10, comple... 40 4.1
32gb|AC137820.11| Medicago truncatula clone mth2-15f9, complete se... 40 4.1
33gb|AC136954.14| Medicago truncatula clone mth2-7i1, complete seq... 40 4.1
34gb|BC100250.1| Rattus norvegicus cDNA clone IMAGE:7444920, with ... 40 4.1
35gb|AC139191.1| Pan troglodytes BAC clone RP43-32G19 from Y, comp... 40 4.1
36gb|AC142301.1| Pan troglodytes BAC clone RP43-127N2 from Y, comp... 40 4.1
37gb|AC139193.1| Pan troglodytes BAC clone RP43-131F11 from Y, com... 40 4.1
38emb|AL512656.16| Human DNA sequence from clone RP11-537A6 on chr... 40 4.1
39emb|AL035252.5|HS738P15 Human DNA sequence from clone RP4-738P15... 40 4.1
40gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, co... 40 4.1
41gb|AC163342.2| Mus musculus BAC clone RP24-115M13 from chromosom... 40 4.1
42gb|AC163719.4| Mus musculus BAC clone RP23-421M6 from chromosome... 40 4.1
43emb|BX510303.6| Zebrafish DNA sequence from clone DKEY-184B7 in ... 40 4.1
44gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 4.1
45dbj|AK095800.1| Homo sapiens cDNA FLJ38481 fis, clone FEBRA2022956 40 4.1
46gb|AC016394.13| Homo sapiens chromosome 10 clone RP11-152N13, co... 40 4.1
47gb|AC109136.1| Homo sapiens chromosome 16 clone RP11-629D22, com... 40 4.1
48gb|AF414183.1| Homo sapiens deleted in azoospermia 1 (DAZ1) gene... 40 4.1
49gb|AC139035.12| Mus musculus chromosome 5, clone RP23-348E9, com... 40 4.1
50gb|AC032011.15| Homo sapiens chromosome 15, clone RP11-435J9, co... 40 4.1
51gb|AC091394.2|AC091394 Homo sapiens chromosome 5 clone CTD-2231K... 40 4.1
52emb|BX465854.7| Zebrafish DNA sequence from clone DKEY-208M10 in... 40 4.1
53gb|AC146477.3| Pan troglodytes BAC clone CH251-514B8 from chromo... 40 4.1
54gb|AC010089.4|AC010089 Homo sapiens BAC clone RP11-290O3 from Y,... 40 4.1
55gb|AC053490.2|AC053490 Homo sapiens BAC clone RP11-140H23 from Y... 40 4.1
56ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 40 4.1
57gb|AF164343.1|AF164343 Homo sapiens chromosome Y BAC clone 148I1... 40 4.1
58gb|AC000021.1|HSAC000021 Origins of the DAZ gene cluster on the ... 40 4.1
59gb|DQ004855.1| Listeria bacteriophage P100, complete genome 40 4.1 
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                           
Query: 214     gcttcttctttttccttctctcgcccccacccgacctatccgaccgcttcgactgctcct 273
               |||| |||||||||||| | ||  ||||| | ||||||||||| ||  | || || ||||
Sbjct: 2833116 gctttttctttttccttttttcagccccatctgacctatccgatcgtcttgattgttcct 2833057

                                     
Query: 274     gcctgatctccatgagcttcgc 295
               ||||||||||||| ||||||||
Sbjct: 2833056 gcctgatctccatcagcttcgc 2833035
to top
>gb|AY224574.1| Oryza sativa (japonica cultivar-group) isolate 29961 WD repeat
           protein mRNA, partial cds
          Length = 687

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 214 gcttcttctttttccttctctcgcccccacccgacctatccgaccgcttcgactgctcct 273
           |||| |||||||||||| | ||  ||||| | ||||||||||| ||  | || || ||||
Sbjct: 664 gctttttctttttccttttttcagccccatctgacctatccgatcgtcttgattgttcct 605

                                 
Query: 274 gcctgatctccatgagcttcgc 295
           ||||||||||||| ||||||||
Sbjct: 604 gcctgatctccatcagcttcgc 583
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                           
Query: 214     gcttcttctttttccttctctcgcccccacccgacctatccgaccgcttcgactgctcct 273
               |||| |||||||||||| | ||  ||||| | ||||||||||| ||  | || || ||||
Sbjct: 2833227 gctttttctttttccttttttcagccccatctgacctatccgatcgtcttgattgttcct 2833168

                                     
Query: 274     gcctgatctccatgagcttcgc 295
               ||||||||||||| ||||||||
Sbjct: 2833167 gcctgatctccatcagcttcgc 2833146
to top
>gb|AC137635.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0038D20, from chromosome 3, complete sequence
          Length = 165395

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                          
Query: 214    gcttcttctttttccttctctcgcccccacccgacctatccgaccgcttcgactgctcct 273
              |||| |||||||||||| | ||  ||||| | ||||||||||| ||  | || || ||||
Sbjct: 105072 gctttttctttttccttttttcagccccatctgacctatccgatcgtcttgattgttcct 105013

                                    
Query: 274    gcctgatctccatgagcttcgc 295
              ||||||||||||| ||||||||
Sbjct: 105012 gcctgatctccatcagcttcgc 104991
to top
>dbj|AK111951.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-E04, full
            insert sequence
          Length = 1329

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                        
Query: 214  gcttcttctttttccttctctcgcccccacccgacctatccgaccgcttcgactgctcct 273
            |||| |||||||||||| | ||  ||||| | ||||||||||| ||  | || || ||||
Sbjct: 1157 gctttttctttttccttttttcagccccatctgacctatccgatcgtcttgattgttcct 1098

                                  
Query: 274  gcctgatctccatgagcttcgc 295
            ||||||||||||| ||||||||
Sbjct: 1097 gcctgatctccatcagcttcgc 1076
to top
>dbj|AK101270.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033032N04, full
            insert sequence
          Length = 3109

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                        
Query: 214  gcttcttctttttccttctctcgcccccacccgacctatccgaccgcttcgactgctcct 273
            |||| |||||||||||| | ||  ||||| | ||||||||||| ||  | || || ||||
Sbjct: 2869 gctttttctttttccttttttcagccccatctgacctatccgatcgtcttgattgttcct 2810

                                  
Query: 274  gcctgatctccatgagcttcgc 295
            ||||||||||||| ||||||||
Sbjct: 2809 gcctgatctccatcagcttcgc 2788
to top
>gb|AC127364.3| Mus musculus BAC clone RP23-3F6 from chromosome 1, complete sequence
          Length = 204558

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 77    cacacacacatctctcaaaattgt 100
             ||||||||||||||||||||||||
Sbjct: 95891 cacacacacatctctcaaaattgt 95868
to top
>gb|AC146939.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0064M09
              map near S6115, complete sequence
          Length = 215240

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 215    cttcttctttttccttctctc 235
              |||||||||||||||||||||
Sbjct: 107429 cttcttctttttccttctctc 107449
to top
>gb|U00032.2| Caenorhabditis elegans cosmid F37A4, complete sequence
          Length = 50335

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 214   gcttcttctttttccttctct 234
             |||||||||||||||||||||
Sbjct: 20029 gcttcttctttttccttctct 20009
to top
>gb|AC138364.8| Mus musculus chromosome 7, clone RP23-243D10, complete sequence
          Length = 199717

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 214    gcttcttctttttccttctct 234
              |||||||||||||||||||||
Sbjct: 127200 gcttcttctttttccttctct 127220
to top
>emb|AL356862.10| Human DNA sequence from clone RP11-1M19 on chromosome 9q34.11-34.3
             Contains part of the RALGPS1A gene for Ral guanine
             nucleotide exchange factor RalGPS1A (RALGEF2, KIAA0351)
             and the ANGPTL2 gene for angiopoietin-like 2
             (angiopoietin-related protein 2)(ARP2, HARP), complete
             sequence
          Length = 145481

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 215   cttcttctttttccttctctc 235
             |||||||||||||||||||||
Sbjct: 10262 cttcttctttttccttctctc 10282
to top
>emb|AL354826.6| Human DNA sequence from clone RP11-286M16 on chromosome 1 Contains a
              novel gene, complete sequence
          Length = 203279

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 215    cttcttctttttccttctctc 235
              |||||||||||||||||||||
Sbjct: 105133 cttcttctttttccttctctc 105113
to top
>emb|Z35768.1|SCYBL007C S.cerevisiae chromosome II reading frame ORF YBL007c
          Length = 4523

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 208  gcttgggcttcttctttttccttctctcg 236
            |||||| ||||||||||||||||| ||||
Sbjct: 3384 gcttggccttcttctttttccttccctcg 3412
to top
>emb|Z22810.1|SCSLA1PA S.cerevisiae of Sla1p gene, complete CDS
          Length = 4407

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 208  gcttgggcttcttctttttccttctctcg 236
            |||||| ||||||||||||||||| ||||
Sbjct: 1268 gcttggccttcttctttttccttccctcg 1240
to top
>gb|S47695.1| YBL03-16=basic motif/leucine zipper domain protein homolog,
             YBL03-23=multidrug resistance PDR1 protein homolog
             [Saccharomyces cerevisiae, S288C, Genomic, 10 genes, 12684
             nt]
          Length = 12684

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 208   gcttgggcttcttctttttccttctctcg 236
             |||||| ||||||||||||||||| ||||
Sbjct: 10195 gcttggccttcttctttttccttccctcg 10223
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 215      cttcttctttttccttctctc 235
                |||||||||||||||||||||
Sbjct: 12724753 cttcttctttttccttctctc 12724773
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 215      cttcttctttttccttctctc 235
                |||||||||||||||||||||
Sbjct: 12804060 cttcttctttttccttctctc 12804080
to top
>gb|AC084323.28| Mus musculus strain C57BL/6J chromosome 2 clone rp23-403l21, complete
              sequence
          Length = 188905

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 90     ctcaaaattgtgctgtgctca 110
              |||||||||||||||||||||
Sbjct: 173533 ctcaaaattgtgctgtgctca 173553
to top
>emb|AL833786.8| Mouse DNA sequence from clone RP23-220D12 on chromosome 2, complete
             sequence
          Length = 194536

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 90    ctcaaaattgtgctgtgctca 110
             |||||||||||||||||||||
Sbjct: 92033 ctcaaaattgtgctgtgctca 92053
to top
>gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, complete sequence
          Length = 207418

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    cacacacacatctctcaaaa 96
             ||||||||||||||||||||
Sbjct: 32898 cacacacacatctctcaaaa 32879
to top
>gb|AC147143.2| Pan troglodytes BAC clone CH251-267L18 from Y, complete sequence
          Length = 187629

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 186518 cttcttctttttccttctct 186537



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 175665 cttcttctttttccttctct 175684



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 164813 cttcttctttttccttctct 164832



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 153955 cttcttctttttccttctct 153974



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 143112 cttcttctttttccttctct 143131



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 104531 cttcttctttttccttctct 104512
to top
>gb|AC141647.3| Mus musculus BAC clone RP23-64E12 from chromosome 10, complete sequence
          Length = 217745

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 50875 cttcttctttttccttctct 50894
to top
>gb|AC127224.3| Mus musculus BAC clone RP24-498F21 from chromosome 10, complete sequence
          Length = 162143

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 143543 cttcttctttttccttctct 143562
to top
>gb|AC099594.6| Mus musculus chromosome 15, clone RP23-458G7, complete sequence
          Length = 220242

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 78026 cttcttctttttccttctct 78007
to top
>gb|AC006338.6| Homo sapiens BAC clone RP11-539D10 from Y, complete sequence
          Length = 175990

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 12596 cttcttctttttccttctct 12615



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 215  cttcttctttttccttctct 234
            ||||||||||||||||||||
Sbjct: 1748 cttcttctttttccttctct 1767
to top
>gb|AC118211.10| Mus musculus chromosome 8, clone RP24-223O5, complete sequence
          Length = 192713

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    ttcttctttttccttctctc 235
              ||||||||||||||||||||
Sbjct: 111375 ttcttctttttccttctctc 111394
to top
>emb|BX927312.7| Zebrafish DNA sequence from clone CH211-87G12 in linkage group 12,
             complete sequence
          Length = 124706

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 163   aggtgagtaaaaacagacag 182
             ||||||||||||||||||||
Sbjct: 45881 aggtgagtaaaaacagacag 45862
to top
>gb|AC147515.1| Pan troglodytes BAC clone CH251-558O8 from Y, complete sequence
          Length = 209207

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 90330 cttcttctttttccttctct 90349



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 51745 cttcttctttttccttctct 51726
to top
>gb|AC130543.3| Mus musculus BAC clone RP24-178J22 from chromosome 8, complete sequence
          Length = 147985

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    ttcttctttttccttctctc 235
              ||||||||||||||||||||
Sbjct: 145492 ttcttctttttccttctctc 145511
to top
>gb|AC106738.3| Homo sapiens chromosome 16 clone CTD-3032H12, complete sequence
          Length = 152312

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    cccacacacacatctctcaa 94
             ||||||||||||||||||||
Sbjct: 16016 cccacacacacatctctcaa 15997
to top
>gb|AC122292.4| Mus musculus BAC clone RP23-256J8 from 10, complete sequence
          Length = 159736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 130654 cttcttctttttccttctct 130635
to top
>gb|AC137820.11| Medicago truncatula clone mth2-15f9, complete sequence
          Length = 134674

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 216    ttcttctttttccttctctc 235
              ||||||||||||||||||||
Sbjct: 132492 ttcttctttttccttctctc 132473
to top
>gb|AC136954.14| Medicago truncatula clone mth2-7i1, complete sequence
          Length = 113505

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   ttgggcttcttctttttcct 229
             ||||||||||||||||||||
Sbjct: 51382 ttgggcttcttctttttcct 51401
to top
>gb|BC100250.1| Rattus norvegicus cDNA clone IMAGE:7444920, with apparent retained
            intron
          Length = 2434

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 87   tctctcaaaattgtgctgtgctca 110
            |||| |||||||||||||||||||
Sbjct: 1680 tctcccaaaattgtgctgtgctca 1703
to top
>gb|AC139191.1| Pan troglodytes BAC clone RP43-32G19 from Y, complete sequence
          Length = 170201

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 136354 cttcttctttttccttctct 136373



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 125499 cttcttctttttccttctct 125518



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 86925 cttcttctttttccttctct 86906



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 76069 cttcttctttttccttctct 76050



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 65228 cttcttctttttccttctct 65209
to top
>gb|AC142301.1| Pan troglodytes BAC clone RP43-127N2 from Y, complete sequence
          Length = 108043

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 101138 cttcttctttttccttctct 101157



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 90294 cttcttctttttccttctct 90313



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 79439 cttcttctttttccttctct 79458



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 40862 cttcttctttttccttctct 40843



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 30006 cttcttctttttccttctct 29987
to top
>gb|AC139193.1| Pan troglodytes BAC clone RP43-131F11 from Y, complete sequence
          Length = 36650

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 215  cttcttctttttccttctct 234
            ||||||||||||||||||||
Sbjct: 5357 cttcttctttttccttctct 5338
to top
>emb|AL512656.16| Human DNA sequence from clone RP11-537A6 on chromosome 10 Contains the
             3' end of a novel gene (KIAA0974) (FLJ21536), the DNAJC9
             gene for DnaJ (Hsp40) homolog subfamily C member 9, three
             novel genes, the MRPS16 gene for mitochondrial ribosomal
             protein S16, the gene for tetratricopeptide
             repeat-containing protein (LOC118491) (FLJ25765), the 3'
             end of the ANXA7 gene for annexin A7, two novel genes and
             three CpG islands, complete sequence
          Length = 162901

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 216   ttcttctttttccttctctc 235
             ||||||||||||||||||||
Sbjct: 37394 ttcttctttttccttctctc 37413
to top
>emb|AL035252.5|HS738P15 Human DNA sequence from clone RP4-738P15 on chromosome 20p11.2-11.22
             Contains a novel gene (LOC284798), a novel pseudogene, the
             ENTPD6 gene for ectonucleoside triphosphate
             diphosphohydrolase 6 (putative function) and two CpG
             islands, complete sequence
          Length = 108487

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    ctctcaaaattgtgctgtgc 107
             ||||||||||||||||||||
Sbjct: 26492 ctctcaaaattgtgctgtgc 26511
to top
>gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, complete sequence
          Length = 178651

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 77   cacacacacatctctcaaaa 96
            ||||||||||||||||||||
Sbjct: 1711 cacacacacatctctcaaaa 1730
to top
>gb|AC163342.2| Mus musculus BAC clone RP24-115M13 from chromosome 9, complete sequence
          Length = 204620

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 187828 cttcttctttttccttctct 187847
to top
>gb|AC163719.4| Mus musculus BAC clone RP23-421M6 from chromosome 9, complete
            sequence
          Length = 177404

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 215  cttcttctttttccttctct 234
            ||||||||||||||||||||
Sbjct: 3615 cttcttctttttccttctct 3634
to top
>emb|BX510303.6| Zebrafish DNA sequence from clone DKEY-184B7 in linkage group 13,
             complete sequence
          Length = 80122

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    aacactggcccacacacaca 86
             ||||||||||||||||||||
Sbjct: 41697 aacactggcccacacacaca 41678
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 215      cttcttctttttccttctct 234
                ||||||||||||||||||||
Sbjct: 11296501 cttcttctttttccttctct 11296520



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 215      cttcttctttttccttctct 234
                ||||||||||||||||||||
Sbjct: 11257916 cttcttctttttccttctct 11257897



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3405099 cttcttctttttccttctct 3405118



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3366518 cttcttctttttccttctct 3366499



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3355675 cttcttctttttccttctct 3355656



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3344817 cttcttctttttccttctct 3344798



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3333965 cttcttctttttccttctct 3333946



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3323112 cttcttctttttccttctct 3323093



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3301894 cttcttctttttccttctct 3301875



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3291041 cttcttctttttccttctct 3291022



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3280200 cttcttctttttccttctct 3280181
to top
>dbj|AK095800.1| Homo sapiens cDNA FLJ38481 fis, clone FEBRA2022956
          Length = 3159

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ctctcaaaattgtgctgtgc 107
           ||||||||||||||||||||
Sbjct: 64  ctctcaaaattgtgctgtgc 45
to top
>gb|AC016394.13| Homo sapiens chromosome 10 clone RP11-152N13, complete sequence
          Length = 149726

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    ttcttctttttccttctctc 235
              ||||||||||||||||||||
Sbjct: 147655 ttcttctttttccttctctc 147674
to top
>gb|AC109136.1| Homo sapiens chromosome 16 clone RP11-629D22, complete sequence
          Length = 183080

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     cccacacacacatctctcaa 94
              ||||||||||||||||||||
Sbjct: 152433 cccacacacacatctctcaa 152414
to top
>gb|AF414183.1| Homo sapiens deleted in azoospermia 1 (DAZ1) gene, exons 4 through 7b
            and partial cds
          Length = 2845

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 215  cttcttctttttccttctct 234
            ||||||||||||||||||||
Sbjct: 1746 cttcttctttttccttctct 1765
to top
>gb|AC139035.12| Mus musculus chromosome 5, clone RP23-348E9, complete sequence
          Length = 237627

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    ttcttctttttccttctctc 235
              ||||||||||||||||||||
Sbjct: 181697 ttcttctttttccttctctc 181716
to top
>gb|AC032011.15| Homo sapiens chromosome 15, clone RP11-435J9, complete sequence
          Length = 201200

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   ttcttctttttccttctctc 235
             ||||||||||||||||||||
Sbjct: 88061 ttcttctttttccttctctc 88042
to top
>gb|AC091394.2|AC091394 Homo sapiens chromosome 5 clone CTD-2231K23, complete sequence
          Length = 134928

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 216  ttcttctttttccttctctc 235
            ||||||||||||||||||||
Sbjct: 9283 ttcttctttttccttctctc 9302
to top
>emb|BX465854.7| Zebrafish DNA sequence from clone DKEY-208M10 in linkage group 12,
             complete sequence
          Length = 204314

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 163   aggtgagtaaaaacagacag 182
             ||||||||||||||||||||
Sbjct: 13415 aggtgagtaaaaacagacag 13434
to top
>gb|AC146477.3| Pan troglodytes BAC clone CH251-514B8 from chromosome y, complete
              sequence
          Length = 170833

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 169722 cttcttctttttccttctct 169741



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 131143 cttcttctttttccttctct 131124



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 120290 cttcttctttttccttctct 120271



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 215    cttcttctttttccttctct 234
              ||||||||||||||||||||
Sbjct: 109449 cttcttctttttccttctct 109430
to top
>gb|AC010089.4|AC010089 Homo sapiens BAC clone RP11-290O3 from Y, complete sequence
          Length = 103356

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 67535 cttcttctttttccttctct 67516
to top
>gb|AC053490.2|AC053490 Homo sapiens BAC clone RP11-140H23 from Y, complete sequence
          Length = 103432

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 93280 cttcttctttttccttctct 93299



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 53968 cttcttctttttccttctct 53949



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 43120 cttcttctttttccttctct 43101



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 32280 cttcttctttttccttctct 32261
to top
>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3043276 cttcttctttttccttctct 3043295



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 3032428 cttcttctttttccttctct 3032447



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 2993112 cttcttctttttccttctct 2993093



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 1418041 cttcttctttttccttctct 1418060



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 1378729 cttcttctttttccttctct 1378710



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 1367881 cttcttctttttccttctct 1367862



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     cttcttctttttccttctct 234
               ||||||||||||||||||||
Sbjct: 1357041 cttcttctttttccttctct 1357022
to top
>gb|AF164343.1|AF164343 Homo sapiens chromosome Y BAC clone 148I14 from Deleted in Azoospermia
             (DAZ) locus
          Length = 85674

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 32400 cttcttctttttccttctct 32419



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 21556 cttcttctttttccttctct 21575



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cttcttctttttccttctct 234
             ||||||||||||||||||||
Sbjct: 10712 cttcttctttttccttctct 10731
to top
>gb|AC000021.1|HSAC000021 Origins of the DAZ gene cluster on the human Y chromosome: an
            autosomal gene was transposed, then repeatedly amplified
            and pruned, complete sequence
          Length = 40328

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 215  cttcttctttttccttctct 234
            ||||||||||||||||||||
Sbjct: 3907 cttcttctttttccttctct 3926
to top
>gb|DQ004855.1| Listeria bacteriophage P100, complete genome
          Length = 131384

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 217  tcttctttttccttctctcg 236
            ||||||||||||||||||||
Sbjct: 4334 tcttctttttccttctctcg 4315


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,622,641
Number of Sequences: 3902068
Number of extensions: 3622641
Number of successful extensions: 72031
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 60
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71547
Number of HSP's gapped (non-prelim): 484
length of query: 311
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 289
effective length of database: 17,147,199,772
effective search space: 4955540734108
effective search space used: 4955540734108
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top