>gb|AC106874.4| Homo sapiens BAC clone RP11-390E19 from 2, complete sequence
          Length = 121348

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 10    aactataataaccgaaacagca 31
             ||||||||||||||||||||||
Sbjct: 40431 aactataataaccgaaacagca 40452

>gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, complete sequence
          Length = 1212674

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 28     agcacagatgcacaacacac 47
              ||||||||||||||||||||
Sbjct: 600447 agcacagatgcacaacacac 600428

>ref|NM_139084.1| Rattus norvegicus membrane associated guanylate kinase, WW and PDZ
            domain containing 3 (Magi3), mRNA
          Length = 5924

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cctatgatgttatcttacag 74
            ||||||||||||||||||||
Sbjct: 2685 cctatgatgttatcttacag 2704

>gb|AC025029.16| Homo sapiens 3 BAC RP11-442C9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 92601

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 111   gaggtgagaaggagcacgcacaaa 134
             ||||||||||||| ||||||||||
Sbjct: 75052 gaggtgagaaggatcacgcacaaa 75029

>gb|AC110489.7| Homo sapiens 3 BAC RP11-324N13 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 19236

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 64   ttatcttacagtcaattgaattgg 87
            |||||||| |||||||||||||||
Sbjct: 7958 ttatcttaaagtcaattgaattgg 7981

>gb|AC005414.2| Homo sapiens 12p13.3 PAC RPCI4-696F19 (Roswell Park Cancer Institute
             Human PAC Library) complete sequence
          Length = 109370

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   tgagaggtgagaaggagcac 127
             ||||||||||||||||||||
Sbjct: 33672 tgagaggtgagaaggagcac 33691

>dbj|AK153833.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:C920011M18
            product:hypothetical protein, full insert sequence
          Length = 3249

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 197  cccaagatgactgcaggtca 216
            ||||||||||||||||||||
Sbjct: 2185 cccaagatgactgcaggtca 2204

>dbj|AK155302.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630217G01
            product:unclassifiable, full insert sequence
          Length = 3059

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 197  cccaagatgactgcaggtca 216
            ||||||||||||||||||||
Sbjct: 2726 cccaagatgactgcaggtca 2745

>gb|AF255614.1| Rattus norvegicus scaffolding protein SLIPR (Slipr) mRNA, complete
            cds
          Length = 5924

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cctatgatgttatcttacag 74
            ||||||||||||||||||||
Sbjct: 2685 cctatgatgttatcttacag 2704

>emb|AL593846.15| Mouse DNA sequence from clone RP23-171H16 on chromosome 11, complete
             sequence
          Length = 213263

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   cccaagatgactgcaggtca 216
             ||||||||||||||||||||
Sbjct: 71828 cccaagatgactgcaggtca 71809


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,412,777
Number of Sequences: 3902068
Number of extensions: 2412777
Number of successful extensions: 39918
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39900
Number of HSP's gapped (non-prelim): 18
length of query: 338
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 316
effective length of database: 17,147,199,772
effective search space: 5418515127952
effective search space used: 5418515127952
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)