Clone Name | rbastl47b12 |
---|---|
Clone Library Name | barley_pub |
>gb|AF474982.1| Hordeum vulgare clone BAC 011009, complete sequence Length = 77136 Score = 527 bits (266), Expect = e-147 Identities = 266/266 (100%) Strand = Plus / Minus Query: 1 ccaaaagacgcagcggggcacaacctgcctttcatacaacagcacgaatacagtttcggc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 58759 ccaaaagacgcagcggggcacaacctgcctttcatacaacagcacgaatacagtttcggc 58700 Query: 61 tgtccccgtcatgcattcttactaggaaaccctgtacaacgctgggttacaccttacagt 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 58699 tgtccccgtcatgcattcttactaggaaaccctgtacaacgctgggttacaccttacagt 58640 Query: 121 ccaaaatctcagagagctccctaccgagttttgccttccacggccttcagttaatacacg 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 58639 ccaaaatctcagagagctccctaccgagttttgccttccacggccttcagttaatacacg 58580 Query: 181 catatataggctcaggagaaactgggagcaccctccgtccgttcccttgcttctcctcag 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 58579 catatataggctcaggagaaactgggagcaccctccgtccgttcccttgcttctcctcag 58520 Query: 241 cgacaaaatttgcagcctctagggag 266 |||||||||||||||||||||||||| Sbjct: 58519 cgacaaaatttgcagcctctagggag 58494
>ref|XM_792835.1| PREDICTED: Strongylocentrotus purpuratus similar to coagulation factor V precursor (LOC593356), mRNA Length = 930 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 aacgctgggttacaccttacagtc 121 |||||||||||||| ||||||||| Sbjct: 719 aacgctgggttacagcttacagtc 742
>gb|AC138593.14| Mus musculus chromosome 8, clone RP24-280K15, complete sequence Length = 169176 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 cttactaggaaaccctgtac 97 |||||||||||||||||||| Sbjct: 159652 cttactaggaaaccctgtac 159633
>gb|AC153549.5| Mus musculus 10 BAC RP23-222O23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 217249 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 catgcattcttactaggaaa 89 |||||||||||||||||||| Sbjct: 88005 catgcattcttactaggaaa 88024
>gb|AC099713.5| Mus musculus chromosome 15, clone RP23-447B6, complete sequence Length = 199130 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 aaaatctcagagagctccct 142 |||||||||||||||||||| Sbjct: 165350 aaaatctcagagagctccct 165331
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome Length = 2256640 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 gttttgccttccacggcctt 167 |||||||||||||||||||| Sbjct: 379195 gttttgccttccacggcctt 379176
>gb|AC168051.3| Mus musculus BAC clone RP23-169M5 from chromosome 8, complete sequence Length = 222981 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 cttactaggaaaccctgtac 97 |||||||||||||||||||| Sbjct: 157371 cttactaggaaaccctgtac 157390 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,811,500 Number of Sequences: 3902068 Number of extensions: 1811500 Number of successful extensions: 35288 Number of sequences better than 10.0: 7 Number of HSP's better than 10.0 without gapping: 7 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 35273 Number of HSP's gapped (non-prelim): 15 length of query: 266 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 244 effective length of database: 17,147,199,772 effective search space: 4183916744368 effective search space used: 4183916744368 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)