>gb|U41557.1| Caenorhabditis elegans cosmid C50F7, complete sequence
          Length = 31414

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 62   acttcaaactgtacaacacat 82
            |||||||||||||||||||||
Sbjct: 8253 acttcaaactgtacaacacat 8233

>emb|AL121761.5|HSJ122P22 Human DNA sequence from clone RP1-122P22 on chromosome 20 Contains the 3'
              end the SLC24A3 gene for solute carrier family 24
              (sodium/potassium/calcium exchanger) member 3, a novel gene
              and a CpG island, complete sequence
          Length = 118990

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 345    agcaagcagacctaatttaca 365
              |||||||||||||||||||||
Sbjct: 117220 agcaagcagacctaatttaca 117240

>gb|AC161207.4| Mus musculus chromosome 1, clone RP23-66G23, complete sequence
          Length = 197037

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 166   atatgtttccagtttcctccc 186
             |||||||||||||||||||||
Sbjct: 30787 atatgtttccagtttcctccc 30807

>gb|AC068780.31| Homo sapiens 12 BAC RP11-163B7 (Roswell Park Cancer Institute Human
           BAC Library) complete sequence
          Length = 105836

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 257 tttggagtgcactgcattgta 277
           |||||||||||||||||||||
Sbjct: 101 tttggagtgcactgcattgta 121

>gb|AC138331.4| Homo sapiens 12 BAC RP11-781A6 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 113301

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 257  tttggagtgcactgcattgta 277
            |||||||||||||||||||||
Sbjct: 7616 tttggagtgcactgcattgta 7636

>emb|BX005234.15| Zebrafish DNA sequence from clone DKEY-7J14 in linkage group 16, complete
              sequence
          Length = 222420

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 61     gacttcaaactgtacaacacataat 85
              ||||||||| |||||||||||||||
Sbjct: 213533 gacttcaaaatgtacaacacataat 213509

>gb|AC112941.7| Mus musculus chromosome 1, clone RP23-466C15, complete sequence
          Length = 166705

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 166    atatgtttccagtttcctccc 186
              |||||||||||||||||||||
Sbjct: 105303 atatgtttccagtttcctccc 105323

>emb|Z84720.1|HS450C20 Human DNA sequence from clone RP3-450C20 on chromosome Xq21-22,
             complete sequence
          Length = 118758

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 60    tgacttcaaactgtacaaca 79
             ||||||||||||||||||||
Sbjct: 53479 tgacttcaaactgtacaaca 53498

>emb|X74476.1|HPV34 Human papillomavirus type 34 genomic DNA
          Length = 7723

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 166  atatgtttccagtttcctcc 185
            ||||||||||||||||||||
Sbjct: 2169 atatgtttccagtttcctcc 2150

>gb|AF399922.1| Aedes aegypti glucosamine-fructose-6-phosphate aminotransferase
           gene, complete cds
          Length = 6106

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 80  cataatatcacgcgtcaaaattga 103
           |||||||||| |||||||||||||
Sbjct: 55  cataatatcaagcgtcaaaattga 78

>gb|AC091646.6| Homo sapiens chromosome 18, clone RP11-433A23, complete sequence
          Length = 187755

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 65    tcaaactgtacaacacataa 84
             ||||||||||||||||||||
Sbjct: 83309 tcaaactgtacaacacataa 83328

>gb|AC096865.2| Homo sapiens chromosome 18 clone RP11-600G22, complete sequence
          Length = 194277

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 65     tcaaactgtacaacacataa 84
              ||||||||||||||||||||
Sbjct: 123331 tcaaactgtacaacacataa 123312

>gb|AC026029.8| Homo sapiens BAC clone RP11-16G16 from 4, complete sequence
          Length = 173067

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     tgacttcaaactgtacaaca 79
              ||||||||||||||||||||
Sbjct: 119858 tgacttcaaactgtacaaca 119877

>gb|AC079452.5| Homo sapiens BAC clone RP11-964P11 from 2, complete sequence
          Length = 178573

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     tgacttcaaactgtacaaca 79
              ||||||||||||||||||||
Sbjct: 157740 tgacttcaaactgtacaaca 157759

>emb|BX004821.5| Zebrafish DNA sequence from clone CH211-171A11 in linkage group 19,
             complete sequence
          Length = 127311

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   cagtttcctccccatataca 194
             ||||||||||||||||||||
Sbjct: 27011 cagtttcctccccatataca 27030

>gb|AE003818.3| Drosophila melanogaster chromosome 2R, section 32 of 73 of the complete
             sequence
          Length = 291923

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   taaattacgggtatatgttt 173
             ||||||||||||||||||||
Sbjct: 83152 taaattacgggtatatgttt 83133

>gb|AC006422.1|AC006422 Drosophila melanogaster, chromosome 2R, region 50A2-50A3, P1 clones
              DS08976 and DS01149, complete sequence
          Length = 129605

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 154    taaattacgggtatatgttt 173
              ||||||||||||||||||||
Sbjct: 124008 taaattacgggtatatgttt 123989

>gb|AC091144.12| Homo sapiens chromosome 8, clone RP11-359B20, complete sequence
          Length = 185872

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 223   ccatgcccagcaattttgca 242
             ||||||||||||||||||||
Sbjct: 28021 ccatgcccagcaattttgca 28002


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,584,395
Number of Sequences: 3902068
Number of extensions: 3584395
Number of successful extensions: 64741
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64715
Number of HSP's gapped (non-prelim): 26
length of query: 408
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 386
effective length of database: 17,147,199,772
effective search space: 6618819111992
effective search space used: 6618819111992
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)