>dbj|AP001184.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-715F10, complete
             sequences
          Length = 120186

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 23    aatcttttcacattagcaaat 43
             |||||||||||||||||||||
Sbjct: 71195 aatcttttcacattagcaaat 71215

>ref|XM_773921.1| Giardia lamblia ATCC 50803 LIM-binding factor (GLP_49_15981_21863)
            partial mRNA
          Length = 5883

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 155  ttaaccagctcaatattattgagc 178
            |||| |||||||||||||||||||
Sbjct: 3974 ttaagcagctcaatattattgagc 3997

>gb|AC164955.2| Mus musculus BAC clone RP24-233H9 from chromosome 9, complete sequence
          Length = 221907

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    aaaagagacacttgcccaca 202
              ||||||||||||||||||||
Sbjct: 216182 aaaagagacacttgcccaca 216163

>gb|AC112210.2| Homo sapiens chromosome 3 clone RP11-221D23, complete sequence
          Length = 146699

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 58     acagccattgtgtggaggtggcct 81
              |||||| |||||||||||||||||
Sbjct: 108454 acagcctttgtgtggaggtggcct 108431

>gb|AC154357.2| Mus musculus BAC clone RP23-192E11 from chromosome 9, complete sequence
          Length = 195151

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   aaaagagacacttgcccaca 202
             ||||||||||||||||||||
Sbjct: 15890 aaaagagacacttgcccaca 15871


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,052,367
Number of Sequences: 3902068
Number of extensions: 2052367
Number of successful extensions: 32634
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32626
Number of HSP's gapped (non-prelim): 8
length of query: 299
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 277
effective length of database: 17,147,199,772
effective search space: 4749774336844
effective search space used: 4749774336844
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)