ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl47a02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 44 0.33
2gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 44 0.33
3gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 44 0.33
4gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 44 0.33
5dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 44 0.33
6emb|AL132641.3|CNS01DT6 Human chromosome 14 DNA sequence BAC C-3... 44 0.33
7gb|AC123924.4| Mus musculus BAC clone RP24-292A3 from chromosome... 42 1.3
8gb|AC165346.4| Mus musculus BAC clone RP23-354N5 from chromosome... 40 5.2
9gb|AC132085.3| Mus musculus BAC clone RP24-550M24 from chromosom... 40 5.2
10gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete s... 40 5.2
11gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, comp... 40 5.2
12emb|Z69707.1|HSCE95B9 Human DNA sequence from clone LL22NC01-95B... 40 5.2
13emb|AL158038.10| Human DNA sequence from clone RP11-298H15 on ch... 40 5.2
14gb|AY119599.1| Drosophila melanogaster LD20420 full insert cDNA 40 5.2
15gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence 40 5.2
16gb|AC109473.2| Homo sapiens chromosome 5 clone RP11-3B10, comple... 40 5.2
17ref|NM_132266.1| Drosophila melanogaster CG12081-RA (CG12081), mRNA 40 5.2
18gb|AC099059.2| Homo sapiens chromosome 3 clone RP11-756A10, comp... 40 5.2
19gb|AC154373.2| Mus musculus BAC clone RP23-79I18 from chromosome... 40 5.2
20gb|AC008575.7| Homo sapiens chromosome 5 clone CTC-554D6, comple... 40 5.2
21gb|AC079463.3|AC079463 Homo sapiens chromosome 5 clone CTB-123N6... 40 5.2
22gb|AC090260.13| Homo sapiens chromosome 15, clone RP11-285A1, co... 40 5.2
23gb|AC023743.4| Drosophila melanogaster X BAC RP98-40O10 (Roswell... 40 5.2
24emb|BX088528.7| Zebrafish DNA sequence from clone CH211-226D23 i... 40 5.2
25emb|AL929201.6| Zebrafish DNA sequence from clone CH211-66G24 in... 40 5.2
26emb|AL953910.14| Zebrafish DNA sequence from clone DKEY-31E10 in... 40 5.2
27gb|AE003444.3| Drosophila melanogaster chromosome X, section 28 ... 40 5.2
28emb|CT030635.8| Mouse DNA sequence from clone RP23-94N7 on chrom... 40 5.2
29gb|AC136500.1| Homo sapiens chromosome 5 clone RP11-56P2, comple... 40 5.2

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 226     tcaatggatcaaattacgtctgcacaaaat 255
               |||||||| |||||||| ||||||||||||
Sbjct: 1189518 tcaatggaacaaattacttctgcacaaaat 1189547



to top

>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 226     tcaatggatcaaattacgtctgcacaaaat 255
               |||||||| |||||||| ||||||||||||
Sbjct: 1154421 tcaatggaacaaattacttctgcacaaaat 1154450



to top

>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 226     tcaatggatcaaattacgtctgcacaaaat 255
               |||||||| |||||||| ||||||||||||
Sbjct: 1050759 tcaatggaacaaattacttctgcacaaaat 1050788



to top

>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 226     tcaatggatcaaattacgtctgcacaaaat 255
               |||||||| |||||||| ||||||||||||
Sbjct: 1130883 tcaatggaacaaattacttctgcacaaaat 1130912



to top

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 226     tcaatggatcaaattacgtctgcacaaaat 255
               |||||||| |||||||| ||||||||||||
Sbjct: 1113190 tcaatggaacaaattacttctgcacaaaat 1113219



to top

>emb|AL132641.3|CNS01DT6 Human chromosome 14 DNA sequence BAC C-3175A2 of library CalTech-D from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 136603

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 24    aattcatgtaatatacagtcta 45
             ||||||||||||||||||||||
Sbjct: 49539 aattcatgtaatatacagtcta 49560



to top

>gb|AC123924.4| Mus musculus BAC clone RP24-292A3 from chromosome 16, complete sequence
          Length = 159639

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 255    tgatgctatttcttttcattgctgg 279
              |||||||||| ||||||||||||||
Sbjct: 106741 tgatgctattgcttttcattgctgg 106765



to top

>gb|AC165346.4| Mus musculus BAC clone RP23-354N5 from chromosome 13, complete sequence
          Length = 233740

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   accgttcttccaaacacttc 318
             ||||||||||||||||||||
Sbjct: 48244 accgttcttccaaacacttc 48225



to top

>gb|AC132085.3| Mus musculus BAC clone RP24-550M24 from chromosome 13, complete sequence
          Length = 150362

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 299    accgttcttccaaacacttc 318
              ||||||||||||||||||||
Sbjct: 136870 accgttcttccaaacacttc 136851



to top

>gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete sequence
          Length = 125129

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    tcctcacttttgaggttttc 112
             ||||||||||||||||||||
Sbjct: 90566 tcctcacttttgaggttttc 90547



to top

>gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, complete sequence
          Length = 198564

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 247    gcacaaaatgatgctatttctttt 270
              |||||||||||| |||||||||||
Sbjct: 176551 gcacaaaatgatactatttctttt 176528



to top

>emb|Z69707.1|HSCE95B9 Human DNA sequence from clone LL22NC01-95B9 on chromosome 22,
            complete sequence
          Length = 30829

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 263  tttcttttcattgctggaaa 282
            ||||||||||||||||||||
Sbjct: 9862 tttcttttcattgctggaaa 9843



to top

>emb|AL158038.10| Human DNA sequence from clone RP11-298H15 on chromosome 13q21.1-21.3,
             complete sequence
          Length = 160015

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 177   gcagccaaaacacacatcacaaaa 200
             ||||||||||||||||| ||||||
Sbjct: 50750 gcagccaaaacacacatgacaaaa 50727



to top

>gb|AY119599.1| Drosophila melanogaster LD20420 full insert cDNA
          Length = 1905

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 173 ccaagcagccaaaacacaca 192
           ||||||||||||||||||||
Sbjct: 217 ccaagcagccaaaacacaca 198



to top

>gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence
          Length = 202653

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tttcttttcattgctggaaa 282
              ||||||||||||||||||||
Sbjct: 101711 tttcttttcattgctggaaa 101692



to top

>gb|AC109473.2| Homo sapiens chromosome 5 clone RP11-3B10, complete sequence
          Length = 170363

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   cacaaaatgatgctatttct 267
             ||||||||||||||||||||
Sbjct: 57264 cacaaaatgatgctatttct 57283



to top

>ref|NM_132266.1| Drosophila melanogaster CG12081-RA (CG12081), mRNA
          Length = 1887

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 173 ccaagcagccaaaacacaca 192
           ||||||||||||||||||||
Sbjct: 217 ccaagcagccaaaacacaca 198



to top

>gb|AC099059.2| Homo sapiens chromosome 3 clone RP11-756A10, complete sequence
          Length = 158576

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 177    gcagccaaaacacacatcacaaaa 200
              ||||||||||||||||| ||||||
Sbjct: 130991 gcagccaaaacacacatgacaaaa 130968



to top

>gb|AC154373.2| Mus musculus BAC clone RP23-79I18 from chromosome 9, complete sequence
          Length = 225286

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   aaaatgatgctatttctttt 270
             ||||||||||||||||||||
Sbjct: 45832 aaaatgatgctatttctttt 45851



to top

>gb|AC008575.7| Homo sapiens chromosome 5 clone CTC-554D6, complete sequence
          Length = 168285

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   cacaaaatgatgctatttct 267
             ||||||||||||||||||||
Sbjct: 30949 cacaaaatgatgctatttct 30930



to top

>gb|AC079463.3|AC079463 Homo sapiens chromosome 5 clone CTB-123N6, complete sequence
          Length = 106514

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   cacaaaatgatgctatttct 267
             ||||||||||||||||||||
Sbjct: 72866 cacaaaatgatgctatttct 72885



to top

>gb|AC090260.13| Homo sapiens chromosome 15, clone RP11-285A1, complete sequence
          Length = 207206

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 170    tctccaagcagccaaaacac 189
              ||||||||||||||||||||
Sbjct: 106879 tctccaagcagccaaaacac 106860



to top

>gb|AC023743.4| Drosophila melanogaster X BAC RP98-40O10 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 185405

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   ccaagcagccaaaacacaca 192
             ||||||||||||||||||||
Sbjct: 56718 ccaagcagccaaaacacaca 56699



to top

>emb|BX088528.7| Zebrafish DNA sequence from clone CH211-226D23 in linkage group 1,
             complete sequence
          Length = 171618

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   atgatgctatttcttttcat 273
             ||||||||||||||||||||
Sbjct: 93814 atgatgctatttcttttcat 93795



to top

>emb|AL929201.6| Zebrafish DNA sequence from clone CH211-66G24 in linkage group 8,
              complete sequence
          Length = 186121

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 183    aaaacacacatcacaaaagtgtgc 206
              |||||||||| |||||||||||||
Sbjct: 129233 aaaacacacaacacaaaagtgtgc 129210



to top

>emb|AL953910.14| Zebrafish DNA sequence from clone DKEY-31E10 in linkage group 1, complete
              sequence
          Length = 190793

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    atgatgctatttcttttcat 273
              ||||||||||||||||||||
Sbjct: 119989 atgatgctatttcttttcat 119970



to top

>gb|AE003444.3| Drosophila melanogaster chromosome X, section 28 of 74 of the complete
              sequence
          Length = 299633

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 173    ccaagcagccaaaacacaca 192
              ||||||||||||||||||||
Sbjct: 173763 ccaagcagccaaaacacaca 173744



to top

>emb|CT030635.8| Mouse DNA sequence from clone RP23-94N7 on chromosome 9, complete
             sequence
          Length = 228508

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 251   aaaatgatgctatttctttt 270
             ||||||||||||||||||||
Sbjct: 79251 aaaatgatgctatttctttt 79232



to top

>gb|AC136500.1| Homo sapiens chromosome 5 clone RP11-56P2, complete sequence
          Length = 183967

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   cacaaaatgatgctatttct 267
             ||||||||||||||||||||
Sbjct: 47435 cacaaaatgatgctatttct 47454


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,589,156
Number of Sequences: 3902068
Number of extensions: 3589156
Number of successful extensions: 72437
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72322
Number of HSP's gapped (non-prelim): 115
length of query: 389
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 367
effective length of database: 17,147,199,772
effective search space: 6293022316324
effective search space used: 6293022316324
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top