Clone Name | rbastl47a02 |
---|---|
Clone Library Name | barley_pub |
>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome Length = 2878529 Score = 44.1 bits (22), Expect = 0.33 Identities = 28/30 (93%) Strand = Plus / Plus Query: 226 tcaatggatcaaattacgtctgcacaaaat 255 |||||||| |||||||| |||||||||||| Sbjct: 1189518 tcaatggaacaaattacttctgcacaaaat 1189547
>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome Length = 2809422 Score = 44.1 bits (22), Expect = 0.33 Identities = 28/30 (93%) Strand = Plus / Plus Query: 226 tcaatggatcaaattacgtctgcacaaaat 255 |||||||| |||||||| |||||||||||| Sbjct: 1154421 tcaatggaacaaattacttctgcacaaaat 1154450
>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome Length = 2821361 Score = 44.1 bits (22), Expect = 0.33 Identities = 28/30 (93%) Strand = Plus / Plus Query: 226 tcaatggatcaaattacgtctgcacaaaat 255 |||||||| |||||||| |||||||||||| Sbjct: 1050759 tcaatggaacaaattacttctgcacaaaat 1050788
>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome Length = 2872769 Score = 44.1 bits (22), Expect = 0.33 Identities = 28/30 (93%) Strand = Plus / Plus Query: 226 tcaatggatcaaattacgtctgcacaaaat 255 |||||||| |||||||| |||||||||||| Sbjct: 1130883 tcaatggaacaaattacttctgcacaaaat 1130912
>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome Length = 2814816 Score = 44.1 bits (22), Expect = 0.33 Identities = 28/30 (93%) Strand = Plus / Plus Query: 226 tcaatggatcaaattacgtctgcacaaaat 255 |||||||| |||||||| |||||||||||| Sbjct: 1113190 tcaatggaacaaattacttctgcacaaaat 1113219
>emb|AL132641.3|CNS01DT6 Human chromosome 14 DNA sequence BAC C-3175A2 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 136603 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 aattcatgtaatatacagtcta 45 |||||||||||||||||||||| Sbjct: 49539 aattcatgtaatatacagtcta 49560
>gb|AC123924.4| Mus musculus BAC clone RP24-292A3 from chromosome 16, complete sequence Length = 159639 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 255 tgatgctatttcttttcattgctgg 279 |||||||||| |||||||||||||| Sbjct: 106741 tgatgctattgcttttcattgctgg 106765
>gb|AC165346.4| Mus musculus BAC clone RP23-354N5 from chromosome 13, complete sequence Length = 233740 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 299 accgttcttccaaacacttc 318 |||||||||||||||||||| Sbjct: 48244 accgttcttccaaacacttc 48225
>gb|AC132085.3| Mus musculus BAC clone RP24-550M24 from chromosome 13, complete sequence Length = 150362 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 299 accgttcttccaaacacttc 318 |||||||||||||||||||| Sbjct: 136870 accgttcttccaaacacttc 136851
>gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete sequence Length = 125129 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 tcctcacttttgaggttttc 112 |||||||||||||||||||| Sbjct: 90566 tcctcacttttgaggttttc 90547
>gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, complete sequence Length = 198564 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 247 gcacaaaatgatgctatttctttt 270 |||||||||||| ||||||||||| Sbjct: 176551 gcacaaaatgatactatttctttt 176528
>emb|Z69707.1|HSCE95B9 Human DNA sequence from clone LL22NC01-95B9 on chromosome 22, complete sequence Length = 30829 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 263 tttcttttcattgctggaaa 282 |||||||||||||||||||| Sbjct: 9862 tttcttttcattgctggaaa 9843
>emb|AL158038.10| Human DNA sequence from clone RP11-298H15 on chromosome 13q21.1-21.3, complete sequence Length = 160015 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 177 gcagccaaaacacacatcacaaaa 200 ||||||||||||||||| |||||| Sbjct: 50750 gcagccaaaacacacatgacaaaa 50727
>gb|AY119599.1| Drosophila melanogaster LD20420 full insert cDNA Length = 1905 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 ccaagcagccaaaacacaca 192 |||||||||||||||||||| Sbjct: 217 ccaagcagccaaaacacaca 198
>gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence Length = 202653 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 263 tttcttttcattgctggaaa 282 |||||||||||||||||||| Sbjct: 101711 tttcttttcattgctggaaa 101692
>gb|AC109473.2| Homo sapiens chromosome 5 clone RP11-3B10, complete sequence Length = 170363 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 cacaaaatgatgctatttct 267 |||||||||||||||||||| Sbjct: 57264 cacaaaatgatgctatttct 57283
>ref|NM_132266.1| Drosophila melanogaster CG12081-RA (CG12081), mRNA Length = 1887 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 ccaagcagccaaaacacaca 192 |||||||||||||||||||| Sbjct: 217 ccaagcagccaaaacacaca 198
>gb|AC099059.2| Homo sapiens chromosome 3 clone RP11-756A10, complete sequence Length = 158576 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 177 gcagccaaaacacacatcacaaaa 200 ||||||||||||||||| |||||| Sbjct: 130991 gcagccaaaacacacatgacaaaa 130968
>gb|AC154373.2| Mus musculus BAC clone RP23-79I18 from chromosome 9, complete sequence Length = 225286 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 aaaatgatgctatttctttt 270 |||||||||||||||||||| Sbjct: 45832 aaaatgatgctatttctttt 45851
>gb|AC008575.7| Homo sapiens chromosome 5 clone CTC-554D6, complete sequence Length = 168285 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 cacaaaatgatgctatttct 267 |||||||||||||||||||| Sbjct: 30949 cacaaaatgatgctatttct 30930
>gb|AC079463.3|AC079463 Homo sapiens chromosome 5 clone CTB-123N6, complete sequence Length = 106514 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 cacaaaatgatgctatttct 267 |||||||||||||||||||| Sbjct: 72866 cacaaaatgatgctatttct 72885
>gb|AC090260.13| Homo sapiens chromosome 15, clone RP11-285A1, complete sequence Length = 207206 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 170 tctccaagcagccaaaacac 189 |||||||||||||||||||| Sbjct: 106879 tctccaagcagccaaaacac 106860
>gb|AC023743.4| Drosophila melanogaster X BAC RP98-40O10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185405 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 ccaagcagccaaaacacaca 192 |||||||||||||||||||| Sbjct: 56718 ccaagcagccaaaacacaca 56699
>emb|BX088528.7| Zebrafish DNA sequence from clone CH211-226D23 in linkage group 1, complete sequence Length = 171618 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 atgatgctatttcttttcat 273 |||||||||||||||||||| Sbjct: 93814 atgatgctatttcttttcat 93795
>emb|AL929201.6| Zebrafish DNA sequence from clone CH211-66G24 in linkage group 8, complete sequence Length = 186121 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 183 aaaacacacatcacaaaagtgtgc 206 |||||||||| ||||||||||||| Sbjct: 129233 aaaacacacaacacaaaagtgtgc 129210
>emb|AL953910.14| Zebrafish DNA sequence from clone DKEY-31E10 in linkage group 1, complete sequence Length = 190793 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 atgatgctatttcttttcat 273 |||||||||||||||||||| Sbjct: 119989 atgatgctatttcttttcat 119970
>gb|AE003444.3| Drosophila melanogaster chromosome X, section 28 of 74 of the complete sequence Length = 299633 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 ccaagcagccaaaacacaca 192 |||||||||||||||||||| Sbjct: 173763 ccaagcagccaaaacacaca 173744
>emb|CT030635.8| Mouse DNA sequence from clone RP23-94N7 on chromosome 9, complete sequence Length = 228508 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 251 aaaatgatgctatttctttt 270 |||||||||||||||||||| Sbjct: 79251 aaaatgatgctatttctttt 79232
>gb|AC136500.1| Homo sapiens chromosome 5 clone RP11-56P2, complete sequence Length = 183967 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 cacaaaatgatgctatttct 267 |||||||||||||||||||| Sbjct: 47435 cacaaaatgatgctatttct 47454 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,589,156 Number of Sequences: 3902068 Number of extensions: 3589156 Number of successful extensions: 72437 Number of sequences better than 10.0: 29 Number of HSP's better than 10.0 without gapping: 29 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 72322 Number of HSP's gapped (non-prelim): 115 length of query: 389 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 367 effective length of database: 17,147,199,772 effective search space: 6293022316324 effective search space used: 6293022316324 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)