>gb|AC025794.9| Mus musculus chromosome 19, clone RP23-62O7, complete sequence
          Length = 242418

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 212    gttctttgtggtcctttgttgttcct 237
              ||||||||||| ||||||||||||||
Sbjct: 105785 gttctttgtggacctttgttgttcct 105810

>gb|AY253318.1| HIV-1 isolate 01TZA306 from Tanzania gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8737

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 94   tttctctagctgaaacaaca 113
            ||||||||||||||||||||
Sbjct: 3127 tttctctagctgaaacaaca 3146

>gb|AC130891.4| Homo sapiens 12 BAC RP11-97F22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 32143

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    ccagtagttattattctcca 54
             ||||||||||||||||||||
Sbjct: 19111 ccagtagttattattctcca 19130

>gb|AC140121.4| Homo sapiens 12 BAC RP13-86N24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 39373

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    ccagtagttattattctcca 54
             ||||||||||||||||||||
Sbjct: 19842 ccagtagttattattctcca 19823

>gb|AY463223.1| HIV-1 isolate C.ZA.J54Ma from South Africa, complete genome
          Length = 9117

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 86   aaagattttttctctagctgaaacaaca 113
            ||||||| |||||||| |||||||||||
Sbjct: 3366 aaagattgtttctctaactgaaacaaca 3393

>gb|DQ011177.1| HIV-1 isolate 04ZASK136B1 from South Africa, complete genome
          Length = 9042

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 94   tttctctagctgaaacaaca 113
            ||||||||||||||||||||
Sbjct: 3367 tttctctagctgaaacaaca 3386

>gb|DQ011166.1| HIV-1 isolate 04ZASK135B1 from South Africa, complete genome
          Length = 9073

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 94   tttctctagctgaaacaaca 113
            ||||||||||||||||||||
Sbjct: 3340 tttctctagctgaaacaaca 3359

>emb|AL773508.6| Mouse DNA sequence from clone RP23-253D15 on chromosome 2, complete
             sequence
          Length = 132091

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   tatctccctctcttcttctc 179
             ||||||||||||||||||||
Sbjct: 44695 tatctccctctcttcttctc 44676

>gb|AY713414.1| HIV-1 isolate 94IN_20635-4 from India gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8745

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 86   aaagattttttctctagctgaaacaaca 113
            ||||||| |||||||| |||||||||||
Sbjct: 3119 aaagattgtttctctaactgaaacaaca 3146

>gb|AC079436.2| Rattus norvegicus strain Brown Norway chromosome 4 clone RP31-108L19,
             complete sequence
          Length = 174622

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   atatctccctctcttcttct 178
             ||||||||||||||||||||
Sbjct: 72144 atatctccctctcttcttct 72163

>gb|DQ351226.1| HIV-1 isolate 03ZAPS025MB1 from South Africa, complete genome
          Length = 9081

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 86   aaagattttttctctagctgaaacaaca 113
            ||||||| |||||||| |||||||||||
Sbjct: 3352 aaagattgtttctctaactgaaacaaca 3379


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,510,518
Number of Sequences: 3902068
Number of extensions: 2510518
Number of successful extensions: 42785
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42771
Number of HSP's gapped (non-prelim): 14
length of query: 261
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 239
effective length of database: 17,147,199,772
effective search space: 4098180745508
effective search space used: 4098180745508
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)