ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl46h06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY106189.1| Zea mays PCO067999 mRNA sequence 54 4e-04
2gb|AC102398.12| Mus musculus chromosome 8, clone RP24-213P1, com... 44 0.40
3gb|AC138118.4| Mus musculus BAC clone RP24-219A21 from 8, comple... 44 0.40
4gb|AY693345.1| Saccharomyces cerevisiae clone FLH004547.01X YLL0... 42 1.6
5gb|AY261366.1| African swine fever virus isolate Warthog, comple... 42 1.6
6emb|Z73122.1|SCYLL017W S.cerevisiae chromosome XII reading frame... 42 1.6
7emb|X97560.1|SC32KBF S.cerevisiae 32kb DNA fragment of chromosom... 42 1.6
8emb|X91488.1|SCCEN12RG S.cerevisiae DNA from CEN12 region includ... 42 1.6
9gb|M26647.1|YSCSDC25 Saccharomyces cerevisiae SDC25 gene, comple... 42 1.6
10emb|X03606.1|SCAPSG Yeast APS gene for cytoplasmatic aspartyl-tR... 42 1.6
11emb|AL161851.4|CNS01RHM Human chromosome 14 DNA sequence BAC R-1... 42 1.6
12gb|CP000024.1| Streptococcus thermophilus CNRZ1066, complete genome 40 6.3
13gb|AC139935.5| Mus musculus chromosome 16, clone RP23-383M10, co... 40 6.3
14emb|AL596325.5| Human DNA sequence from clone RP11-359K18 on chr... 40 6.3
15emb|AL109657.8|HSDJ842G6 Human DNA sequence from clone RP5-842G6... 40 6.3
16gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chr... 40 6.3
17gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 40 6.3
18emb|CT485608.3| Mouse DNA sequence from clone RP23-427F9 on chro... 40 6.3
19gb|AC164566.3| Mus musculus BAC clone RP23-94P17 from chromosome... 40 6.3
20gb|CP000023.1| Streptococcus thermophilus LMG 18311, complete ge... 40 6.3

>gb|AY106189.1| Zea mays PCO067999 mRNA sequence
          Length = 762

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 70/83 (84%), Gaps = 1/83 (1%)
 Strand = Plus / Minus

                                                                       
Query: 341 gaagggctctgtttattgaccgccgctcca-gaaataataatttattctccatcgaacat 399
           ||||||||||||| ||||||||||||| ||  ||  ||||||||||| |||||| |||||
Sbjct: 605 gaagggctctgttcattgaccgccgcttcatcaaggaataatttattttccatcaaacat 546

                                  
Query: 400 caaggtaacgaacatctagatta 422
           || ||| |  |||||||| ||||
Sbjct: 545 cagggtcataaacatctaaatta 523



to top

>gb|AC102398.12| Mus musculus chromosome 8, clone RP24-213P1, complete sequence
          Length = 172457

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 174   atcatgcttaccatcagaggtg 195
             ||||||||||||||||||||||
Sbjct: 14698 atcatgcttaccatcagaggtg 14719



to top

>gb|AC138118.4| Mus musculus BAC clone RP24-219A21 from 8, complete sequence
          Length = 168752

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 174    atcatgcttaccatcagaggtg 195
              ||||||||||||||||||||||
Sbjct: 164463 atcatgcttaccatcagaggtg 164484



to top

>gb|AY693345.1| Saccharomyces cerevisiae clone FLH004547.01X YLL017W gene, complete
           cds
          Length = 312

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 284 tatgccggcatgacaactccg 304
           |||||||||||||||||||||
Sbjct: 19  tatgccggcatgacaactccg 39



to top

>gb|AY261366.1| African swine fever virus isolate Warthog, complete genome
          Length = 186528

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 315   aacttctcatgcaccaagtaaacac 339
             |||||||||||||| ||||||||||
Sbjct: 41782 aacttctcatgcacaaagtaaacac 41806



to top

>emb|Z73122.1|SCYLL017W S.cerevisiae chromosome XII reading frame ORF YLL017w
          Length = 1514

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 284 tatgccggcatgacaactccg 304
           |||||||||||||||||||||
Sbjct: 920 tatgccggcatgacaactccg 940



to top

>emb|X97560.1|SC32KBF S.cerevisiae 32kb DNA fragment of chromosome XII, left arm
          Length = 32088

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   tatgccggcatgacaactccg 304
             |||||||||||||||||||||
Sbjct: 21387 tatgccggcatgacaactccg 21407



to top

>emb|X91488.1|SCCEN12RG S.cerevisiae DNA from CEN12 region including ATS/APSG, SCD25, SOF1,
           DRS1, MMM1 and DNM1 genes
          Length = 43676

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 284 tatgccggcatgacaactccg 304
           |||||||||||||||||||||
Sbjct: 920 tatgccggcatgacaactccg 940



to top

>gb|M26647.1|YSCSDC25 Saccharomyces cerevisiae SDC25 gene, complete cds
          Length = 5064

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 284 tatgccggcatgacaactccg 304
           |||||||||||||||||||||
Sbjct: 146 tatgccggcatgacaactccg 166



to top

>emb|X03606.1|SCAPSG Yeast APS gene for cytoplasmatic aspartyl-tRNA synthetase (AspRS)
          Length = 3836

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 tatgccggcatgacaactccg 304
           |||||||||||||||||||||
Sbjct: 937 tatgccggcatgacaactccg 917



to top

>emb|AL161851.4|CNS01RHM Human chromosome 14 DNA sequence BAC R-1078I14 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 187732

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 149    cctgctccttgacacatcagaaatg 173
              ||||||||||||||||||| |||||
Sbjct: 109923 cctgctccttgacacatcaaaaatg 109947



to top

>gb|CP000024.1| Streptococcus thermophilus CNRZ1066, complete genome
          Length = 1796226

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     caaaaattggcagcagaact 87
              ||||||||||||||||||||
Sbjct: 369991 caaaaattggcagcagaact 370010



to top

>gb|AC139935.5| Mus musculus chromosome 16, clone RP23-383M10, complete sequence
          Length = 226328

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  ggtttacattttaacaaagc 129
            ||||||||||||||||||||
Sbjct: 2570 ggtttacattttaacaaagc 2589



to top

>emb|AL596325.5| Human DNA sequence from clone RP11-359K18 on chromosome 1 Contains
             ubiquinol-cytochrome c reductase binding (UQCRB)
             pseudogene, the UAP1 gene for UDP-N-acteylglucosamine
             pyrophosphorylase 1,  the 5' end of the DDR2 gene for
             discoidin domain receptor family member 2 and a CpG
             island, complete sequence
          Length = 152770

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 367   tccagaaataataatttatt 386
             ||||||||||||||||||||
Sbjct: 96239 tccagaaataataatttatt 96220



to top

>emb|AL109657.8|HSDJ842G6 Human DNA sequence from clone RP5-842G6 on chromosome 20 Contains the
             3' end of the C20orf7 gene for chromosome 20 open reading
             frame 7 (FLJ22324) and the 3' end of the C20orf50 gene for
             chromosome 20 open reading frame 50 (dJ631M13.1, similar
             to SEL1L (DKFZp434C1826)), complete sequence
          Length = 100272

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 61    tacagtacaaaaattggcag 80
             ||||||||||||||||||||
Sbjct: 53268 tacagtacaaaaattggcag 53249



to top

>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
               sequence
          Length = 4332241

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 371     gaaataataatttattctcc 390
               ||||||||||||||||||||
Sbjct: 4146310 gaaataataatttattctcc 4146329



to top

>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 371     gaaataataatttattctcc 390
               ||||||||||||||||||||
Sbjct: 4088615 gaaataataatttattctcc 4088634



to top

>emb|CT485608.3| Mouse DNA sequence from clone RP23-427F9 on chromosome 14, complete
              sequence
          Length = 182099

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 104    caggcaggtttacattttaa 123
              ||||||||||||||||||||
Sbjct: 130386 caggcaggtttacattttaa 130367



to top

>gb|AC164566.3| Mus musculus BAC clone RP23-94P17 from chromosome 16, complete sequence
          Length = 203314

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   ggtttacattttaacaaagc 129
             ||||||||||||||||||||
Sbjct: 54969 ggtttacattttaacaaagc 54950



to top

>gb|CP000023.1| Streptococcus thermophilus LMG 18311, complete genome
          Length = 1796846

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     caaaaattggcagcagaact 87
              ||||||||||||||||||||
Sbjct: 376213 caaaaattggcagcagaact 376232


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,162,635
Number of Sequences: 3902068
Number of extensions: 4162635
Number of successful extensions: 74093
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74041
Number of HSP's gapped (non-prelim): 51
length of query: 468
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 446
effective length of database: 17,147,199,772
effective search space: 7647651098312
effective search space used: 7647651098312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top